Incidental Mutation 'R6545:Hectd2'
ID521158
Institutional Source Beutler Lab
Gene Symbol Hectd2
Ensembl Gene ENSMUSG00000041180
Gene NameHECT domain E3 ubiquitin protein ligase 2
SynonymsA630025O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location36554639-36621135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36587378 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 20 (Q20K)
Ref Sequence ENSEMBL: ENSMUSP00000134964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047247] [ENSMUST00000139215] [ENSMUST00000169036] [ENSMUST00000177381]
Predicted Effect probably benign
Transcript: ENSMUST00000047247
AA Change: Q203K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042646
Gene: ENSMUSG00000041180
AA Change: Q203K

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 433 774 1.33e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139215
SMART Domains Protein: ENSMUSP00000117273
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149629
Predicted Effect unknown
Transcript: ENSMUST00000155594
AA Change: Q175K
SMART Domains Protein: ENSMUSP00000120791
Gene: ENSMUSG00000041180
AA Change: Q175K

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
low complexity region 82 101 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169036
AA Change: Q203K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128387
Gene: ENSMUSG00000041180
AA Change: Q203K

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 434 775 1.33e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177381
AA Change: Q20K

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134964
Gene: ENSMUSG00000041180
AA Change: Q20K

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Hectd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Hectd2 APN 19 36584936 missense probably benign
IGL01024:Hectd2 APN 19 36606393 missense probably damaging 1.00
IGL01111:Hectd2 APN 19 36597120 missense probably damaging 1.00
IGL01301:Hectd2 APN 19 36569370 splice site probably benign
IGL02019:Hectd2 APN 19 36615516 missense possibly damaging 0.94
IGL02410:Hectd2 APN 19 36595213 nonsense probably null
IGL02793:Hectd2 APN 19 36587421 missense probably damaging 0.99
IGL03010:Hectd2 APN 19 36615602 missense probably benign 0.01
IGL03115:Hectd2 APN 19 36599721 critical splice donor site probably null
IGL03251:Hectd2 APN 19 36585526 missense probably damaging 1.00
chopstix1 UTSW 19 36609416 missense possibly damaging 0.75
chopstix3 UTSW 19 36615508 nonsense probably null
R0402:Hectd2 UTSW 19 36601529 critical splice donor site probably null
R0415:Hectd2 UTSW 19 36584884 unclassified probably benign
R0576:Hectd2 UTSW 19 36585497 missense probably benign
R0685:Hectd2 UTSW 19 36569431 missense probably damaging 0.99
R1460:Hectd2 UTSW 19 36615508 nonsense probably null
R1791:Hectd2 UTSW 19 36609416 missense possibly damaging 0.75
R1895:Hectd2 UTSW 19 36614460 missense probably damaging 1.00
R1928:Hectd2 UTSW 19 36612319 missense probably damaging 1.00
R2116:Hectd2 UTSW 19 36614424 missense probably damaging 0.99
R2520:Hectd2 UTSW 19 36612233 critical splice donor site probably null
R4693:Hectd2 UTSW 19 36614338 splice site probably benign
R4858:Hectd2 UTSW 19 36605282 missense probably damaging 0.98
R4943:Hectd2 UTSW 19 36604247 splice site probably null
R5031:Hectd2 UTSW 19 36599604 missense probably damaging 1.00
R5408:Hectd2 UTSW 19 36554896 missense possibly damaging 0.46
R5621:Hectd2 UTSW 19 36618751 missense probably damaging 1.00
R5652:Hectd2 UTSW 19 36604320 missense probably damaging 1.00
R5704:Hectd2 UTSW 19 36598891 missense possibly damaging 0.93
R5950:Hectd2 UTSW 19 36597239 intron probably benign
R6414:Hectd2 UTSW 19 36618786 missense probably benign 0.21
R6438:Hectd2 UTSW 19 36618842 makesense probably null
R6544:Hectd2 UTSW 19 36612328 missense probably damaging 1.00
R6629:Hectd2 UTSW 19 36615538 missense probably damaging 1.00
R6672:Hectd2 UTSW 19 36587380 missense probably damaging 1.00
R6741:Hectd2 UTSW 19 36612359 missense probably damaging 1.00
R7117:Hectd2 UTSW 19 36599655 missense probably benign 0.29
R7238:Hectd2 UTSW 19 36597078 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATCCTCATGGCAGTCTAC -3'
(R):5'- CCGGGAAAGGGGATCACATTTG -3'

Sequencing Primer
(F):5'- ATGGCAGTCTACATCGCTG -3'
(R):5'- CGGGAAAGGGGATCACATTTGAAATG -3'
Posted On2018-06-06