Incidental Mutation 'R6546:Rchy1'
ID521182
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Namering finger and CHY zinc finger domain containing 1
SynonymsZfp363, Pirh2, 6720407C15Rik, PRO1996
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R6546 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location91948904-91963068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91957958 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 44 (H44Y)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
PDB Structure
Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031345
AA Change: H44Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: H44Y

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect probably benign
Transcript: ENSMUST00000169948
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202883
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,799,299 L242M probably damaging Het
Atad2b A T 12: 4,990,949 H206L probably damaging Het
Bmp2k A G 5: 97,088,078 Q1120R probably benign Het
Cdk18 G A 1: 132,122,350 T29I probably damaging Het
Chrna3 T A 9: 55,015,901 I208F probably damaging Het
Dhrs1 G A 14: 55,741,272 P140S possibly damaging Het
Dnah14 C T 1: 181,738,987 R2775C probably damaging Het
Fam71e2 T C 7: 4,758,465 D416G probably benign Het
Fnip1 T G 11: 54,502,611 N600K probably benign Het
Jmjd6 T C 11: 116,842,500 Y117C probably damaging Het
Kbtbd4 T A 2: 90,909,291 V340E probably damaging Het
Kif26b T C 1: 178,928,306 V1995A probably damaging Het
Krt10 T C 11: 99,387,395 probably null Het
Macf1 T C 4: 123,432,281 D3022G probably benign Het
Map3k13 C T 16: 21,921,777 T618I probably benign Het
Mat1a G A 14: 41,121,422 V302M probably damaging Het
Med13l T C 5: 118,721,474 F242S probably damaging Het
Npffr2 A T 5: 89,583,012 K267M probably damaging Het
Nupl1 A T 14: 60,223,223 probably null Het
Papss2 A G 19: 32,663,148 Y440C possibly damaging Het
Ppil4 T A 10: 7,798,422 I110N probably damaging Het
Qrfpr G A 3: 36,180,265 T309I probably damaging Het
Rbl2 C A 8: 91,070,370 S65R probably benign Het
Slc19a3 T C 1: 83,026,360 T7A probably benign Het
St7 C T 6: 17,852,314 A233V probably damaging Het
Syn2 T A 6: 115,281,098 S546T probably benign Het
Syne1 A T 10: 5,218,645 Y5245* probably null Het
Trmt6 A G 2: 132,812,153 W52R probably benign Het
Ubr4 G A 4: 139,414,394 V1264M probably damaging Het
Ulk4 A T 9: 121,141,894 V1004D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 T A 6: 124,192,410 H587L possibly damaging Het
Vmn2r79 A G 7: 87,003,533 R478G probably benign Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 91957546 nonsense probably null
IGL02668:Rchy1 APN 5 91962718 start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 91962643 missense probably benign 0.08
R0137:Rchy1 UTSW 5 91957599 missense probably benign 0.01
R0959:Rchy1 UTSW 5 91957617 missense probably damaging 0.99
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1531:Rchy1 UTSW 5 91955615 critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
R4350:Rchy1 UTSW 5 91957954 missense probably damaging 1.00
R4953:Rchy1 UTSW 5 91962628 critical splice donor site probably null
R6223:Rchy1 UTSW 5 91957967 missense probably damaging 1.00
R6345:Rchy1 UTSW 5 91957942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCTCCTCAGAGAATTAAGTCTCATTTC -3'
(R):5'- CTTCTGTTAGGCTGAGAACGAG -3'

Sequencing Primer
(F):5'- CCATACGGCCTTACATGT -3'
(R):5'- ATCTGTGAGCTGCTAGGA -3'
Posted On2018-06-06