Incidental Mutation 'R6521:Sptan1'
ID 521245
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 044647-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6521 (G1)
Quality Score 108.008
Status Validated
Chromosome 2
Chromosomal Location 29855572-29921463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29910467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1831 (S1831P)
Ref Sequence ENSEMBL: ENSMUSP00000092697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably benign
Transcript: ENSMUST00000046257
AA Change: S1811P

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: S1811P

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095083
AA Change: S1831P

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: S1831P

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
AA Change: S1836P

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: S1836P

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
AA Change: S1816P

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: S1816P

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
AA Change: S1816P

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: S1816P

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: S1836P
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: S1836P

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Meta Mutation Damage Score 0.1115 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 T A 8: 111,769,968 (GRCm39) S356T probably benign Het
Acsbg2 T C 17: 57,168,565 (GRCm39) M185V probably benign Het
Adgrv1 A T 13: 81,581,771 (GRCm39) F4758I probably damaging Het
Ank3 A G 10: 69,828,596 (GRCm39) probably benign Het
Ankfy1 G A 11: 72,621,308 (GRCm39) R198Q possibly damaging Het
Ano4 A G 10: 88,819,640 (GRCm39) V537A probably damaging Het
Catsper2 A G 2: 121,237,288 (GRCm39) L204P probably damaging Het
Cdh20 A C 1: 104,869,859 (GRCm39) D193A probably damaging Het
Ceacam5 T C 7: 17,484,756 (GRCm39) probably null Het
Celf4 T A 18: 25,612,531 (GRCm39) probably null Het
Cfap91 A G 16: 38,127,121 (GRCm39) V545A probably benign Het
Crebbp A T 16: 3,936,992 (GRCm39) F754I probably damaging Het
Cyfip2 A T 11: 46,145,415 (GRCm39) I635N probably damaging Het
Erbb4 T A 1: 68,081,689 (GRCm39) D1131V probably damaging Het
Fsip2 A G 2: 82,820,430 (GRCm39) T5388A possibly damaging Het
Hoxc8 G A 15: 102,901,135 (GRCm39) V193M probably benign Het
Klhdc3 A G 17: 46,988,687 (GRCm39) V124A probably benign Het
Klhl18 A G 9: 110,257,703 (GRCm39) I509T possibly damaging Het
Mdfic T A 6: 15,729,027 (GRCm39) probably benign Het
Mkln1 T A 6: 31,467,479 (GRCm39) D64E probably damaging Het
Mmd2 A G 5: 142,560,585 (GRCm39) I112T probably damaging Het
Mpl C T 4: 118,312,314 (GRCm39) probably null Het
Mtmr4 A G 11: 87,504,353 (GRCm39) T1044A possibly damaging Het
Muc5b C A 7: 141,412,908 (GRCm39) Y1951* probably null Het
Myo15a C T 11: 60,393,195 (GRCm39) H2240Y probably damaging Het
Nckap5 A T 1: 126,309,909 (GRCm39) I74K probably damaging Het
Nfxl1 A T 5: 72,697,651 (GRCm39) probably null Het
Or11j4 T C 14: 50,631,005 (GRCm39) V264A possibly damaging Het
Or2ah1 A T 2: 85,653,794 (GRCm39) I160F probably benign Het
Or4c11c A G 2: 88,661,700 (GRCm39) I80V probably benign Het
Or8d2 C T 9: 38,759,893 (GRCm39) T161I probably benign Het
Piezo2 T C 18: 63,154,399 (GRCm39) Y2460C probably damaging Het
Pigx A G 16: 31,906,129 (GRCm39) L64P probably damaging Het
Prss1 C T 6: 41,440,615 (GRCm39) T230I probably damaging Het
Ptma A G 1: 86,455,569 (GRCm39) probably null Het
Rab39 T C 9: 53,617,331 (GRCm39) T29A probably benign Het
Rem2 C T 14: 54,715,144 (GRCm39) A107V possibly damaging Het
Senp1 A G 15: 97,946,152 (GRCm39) V531A probably damaging Het
Serhl A G 15: 82,985,843 (GRCm39) probably null Het
Sirpa T G 2: 129,472,075 (GRCm39) Y164D probably damaging Het
Slc12a3 T C 8: 95,069,741 (GRCm39) I550T possibly damaging Het
Slc22a14 T C 9: 119,049,835 (GRCm39) probably null Het
Slfn5 A G 11: 82,851,241 (GRCm39) N513D probably damaging Het
Swap70 T C 7: 109,855,027 (GRCm39) L109P probably benign Het
Tas2r119 G A 15: 32,178,319 (GRCm39) C295Y probably damaging Het
Tcaf3 T A 6: 42,570,172 (GRCm39) I527L probably damaging Het
Traj31 A G 14: 54,425,387 (GRCm39) probably benign Het
Unc5a T A 13: 55,152,748 (GRCm39) D887E probably benign Het
Zfp407 T A 18: 84,450,536 (GRCm39) H1600L probably damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,883,968 (GRCm39) critical splice donor site probably null
IGL00932:Sptan1 APN 2 29,905,622 (GRCm39) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 29,890,083 (GRCm39) splice site probably benign
IGL01070:Sptan1 APN 2 29,904,185 (GRCm39) critical splice donor site probably null
IGL01625:Sptan1 APN 2 29,916,126 (GRCm39) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 29,908,491 (GRCm39) missense probably benign 0.12
IGL01795:Sptan1 APN 2 29,908,501 (GRCm39) missense probably benign 0.07
IGL01982:Sptan1 APN 2 29,909,980 (GRCm39) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 29,903,725 (GRCm39) missense probably benign 0.43
IGL02158:Sptan1 APN 2 29,920,336 (GRCm39) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 29,920,752 (GRCm39) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 29,906,067 (GRCm39) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 29,908,486 (GRCm39) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,888,195 (GRCm39) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,868,588 (GRCm39) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,886,055 (GRCm39) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,881,045 (GRCm39) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,876,505 (GRCm39) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 29,915,593 (GRCm39) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0094:Sptan1 UTSW 2 29,896,635 (GRCm39) missense probably benign 0.37
R0230:Sptan1 UTSW 2 29,900,704 (GRCm39) splice site probably benign
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,882,764 (GRCm39) splice site probably null
R0368:Sptan1 UTSW 2 29,883,927 (GRCm39) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,881,045 (GRCm39) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 29,918,684 (GRCm39) missense probably null
R0448:Sptan1 UTSW 2 29,916,822 (GRCm39) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 29,903,860 (GRCm39) splice site probably benign
R0580:Sptan1 UTSW 2 29,897,587 (GRCm39) missense probably damaging 0.99
R0739:Sptan1 UTSW 2 29,903,530 (GRCm39) missense probably damaging 1.00
R0924:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0930:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,870,075 (GRCm39) splice site probably null
R1352:Sptan1 UTSW 2 29,911,199 (GRCm39) splice site probably benign
R1456:Sptan1 UTSW 2 29,870,215 (GRCm39) critical splice donor site probably null
R1537:Sptan1 UTSW 2 29,916,034 (GRCm39) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 29,917,139 (GRCm39) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 29,893,348 (GRCm39) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,876,432 (GRCm39) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,882,013 (GRCm39) splice site probably benign
R1879:Sptan1 UTSW 2 29,885,540 (GRCm39) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 29,910,472 (GRCm39) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R1915:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R2022:Sptan1 UTSW 2 29,897,573 (GRCm39) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 29,892,250 (GRCm39) missense probably benign
R2103:Sptan1 UTSW 2 29,920,483 (GRCm39) missense probably damaging 1.00
R2162:Sptan1 UTSW 2 29,908,588 (GRCm39) splice site probably benign
R2931:Sptan1 UTSW 2 29,908,500 (GRCm39) missense probably benign
R3726:Sptan1 UTSW 2 29,908,431 (GRCm39) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 29,920,037 (GRCm39) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 29,916,600 (GRCm39) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 29,915,581 (GRCm39) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 29,919,721 (GRCm39) intron probably benign
R4718:Sptan1 UTSW 2 29,921,074 (GRCm39) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,886,447 (GRCm39) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 29,901,054 (GRCm39) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,868,455 (GRCm39) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5181:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5383:Sptan1 UTSW 2 29,901,340 (GRCm39) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,876,504 (GRCm39) nonsense probably null
R5592:Sptan1 UTSW 2 29,876,731 (GRCm39) intron probably benign
R5639:Sptan1 UTSW 2 29,881,005 (GRCm39) nonsense probably null
R5801:Sptan1 UTSW 2 29,920,613 (GRCm39) splice site probably null
R5947:Sptan1 UTSW 2 29,884,379 (GRCm39) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,886,794 (GRCm39) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,883,899 (GRCm39) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 29,894,535 (GRCm39) missense probably benign 0.01
R6254:Sptan1 UTSW 2 29,897,561 (GRCm39) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 29,908,527 (GRCm39) missense probably damaging 1.00
R6877:Sptan1 UTSW 2 29,920,985 (GRCm39) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,873,221 (GRCm39) missense probably benign 0.02
R7248:Sptan1 UTSW 2 29,892,311 (GRCm39) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,876,941 (GRCm39) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,870,209 (GRCm39) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 29,890,068 (GRCm39) missense probably benign 0.06
R7779:Sptan1 UTSW 2 29,911,319 (GRCm39) missense probably damaging 1.00
R8051:Sptan1 UTSW 2 29,920,171 (GRCm39) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,884,351 (GRCm39) missense probably benign 0.22
R8103:Sptan1 UTSW 2 29,910,055 (GRCm39) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,870,212 (GRCm39) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 29,916,596 (GRCm39) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,873,744 (GRCm39) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 29,920,597 (GRCm39) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 29,920,724 (GRCm39) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,880,977 (GRCm39) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 29,910,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCATGAAGAAGCAATTG -3'
(R):5'- GCTAATACCTGACAGCCCAG -3'

Sequencing Primer
(F):5'- GCCTCCTAAGTGCTGGCATTAAAG -3'
(R):5'- AGGAGGGGCCAGGCTTTC -3'
Posted On 2018-06-06