Incidental Mutation 'R6547:Anxa7'
ID521319
Institutional Source Beutler Lab
Gene Symbol Anxa7
Ensembl Gene ENSMUSG00000021814
Gene Nameannexin A7
Synonymssynexin, Anx7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20455260-20480133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20469393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000153669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065504] [ENSMUST00000100844] [ENSMUST00000224975] [ENSMUST00000225132] [ENSMUST00000225941]
Predicted Effect probably benign
Transcript: ENSMUST00000065504
AA Change: V119A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066035
Gene: ENSMUSG00000021814
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100844
AA Change: V119A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098405
Gene: ENSMUSG00000021814
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224410
Predicted Effect probably benign
Transcript: ENSMUST00000224975
AA Change: V119A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225118
Predicted Effect probably benign
Transcript: ENSMUST00000225132
Predicted Effect probably benign
Transcript: ENSMUST00000225941
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are viable but exhibit altered Ca2+ signaling and/or homeostasis in cardiomyocytes and glia cells, and changes in erythrocyte shape, osmotic resistance, platelet number and aggregation velocity. Homozygotes for another null allele die at ~E10 with cerebral hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Anxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Anxa7 APN 14 20458681 missense possibly damaging 0.87
IGL01137:Anxa7 APN 14 20456580 nonsense probably null
IGL01376:Anxa7 APN 14 20460456 missense probably benign 0.00
IGL01651:Anxa7 APN 14 20456501 missense probably damaging 1.00
IGL02830:Anxa7 APN 14 20456540 missense possibly damaging 0.67
IGL03078:Anxa7 APN 14 20456556 missense probably damaging 0.97
IGL03177:Anxa7 APN 14 20456586 missense probably benign 0.41
FR4449:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4548:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4737:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4976:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
LCD18:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0121:Anxa7 UTSW 14 20460159 missense probably damaging 0.97
R0329:Anxa7 UTSW 14 20469498 splice site probably null
R0330:Anxa7 UTSW 14 20469498 splice site probably null
R1416:Anxa7 UTSW 14 20462707 missense probably damaging 1.00
R1601:Anxa7 UTSW 14 20464615 nonsense probably null
R1701:Anxa7 UTSW 14 20460161 missense probably damaging 1.00
R1794:Anxa7 UTSW 14 20471467 missense unknown
R1828:Anxa7 UTSW 14 20462664 missense probably damaging 1.00
R4676:Anxa7 UTSW 14 20467915 missense probably benign 0.00
R5354:Anxa7 UTSW 14 20464909 missense possibly damaging 0.63
R6985:Anxa7 UTSW 14 20471568 missense unknown
R7226:Anxa7 UTSW 14 20460195 missense probably damaging 0.97
R7267:Anxa7 UTSW 14 20469406 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGAATAGAATCCTGGAGGTGGTTCC -3'
(R):5'- TGTTGCGCTTACCACACATG -3'

Sequencing Primer
(F):5'- AGGTGGTTCCTTCAAAAACTTG -3'
(R):5'- CACATGGCTCTTCATGAAGTAAAGC -3'
Posted On2018-06-06