Incidental Mutation 'R6547:Vmn2r111'
ID521321
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6547 (G1)
Quality Score217.009
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22559051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On2018-06-06