Incidental Mutation 'R6548:Tgfb1'
ID 521363
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Name transforming growth factor, beta 1
Synonyms Tgfb, TGF-beta1, TGF-beta 1, Tgfb-1, TGFbeta1
MMRRC Submission 044673-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R6548 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25386427-25404502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25396350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 214 (I214M)
Ref Sequence ENSEMBL: ENSMUSP00000002678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000169009]
AlphaFold P04202
Predicted Effect probably benign
Transcript: ENSMUST00000002678
AA Change: I214M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603
AA Change: I214M

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171757
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik T C 10: 43,050,769 (GRCm39) L21P probably damaging Het
Ank3 C T 10: 69,728,240 (GRCm39) A642V probably damaging Het
Bap1 A G 14: 30,978,182 (GRCm39) N349S probably benign Het
Brca1 G T 11: 101,415,591 (GRCm39) Q32K probably damaging Het
Ccdc39 A T 3: 33,892,108 (GRCm39) N121K probably benign Het
Champ1 A T 8: 13,930,002 (GRCm39) N720I probably damaging Het
Chd3 T A 11: 69,252,886 (GRCm39) R216* probably null Het
D630003M21Rik A G 2: 158,047,619 (GRCm39) probably null Het
Exoc2 A T 13: 31,010,047 (GRCm39) V804E possibly damaging Het
Fcgbp A G 7: 27,791,343 (GRCm39) N868S probably benign Het
Gm10376 T C 14: 42,873,025 (GRCm39) M1V probably null Het
Gpc2 G A 5: 138,275,533 (GRCm39) probably null Het
Gpr37 G A 6: 25,688,812 (GRCm39) T95I probably benign Het
Ints3 G A 3: 90,299,431 (GRCm39) probably benign Het
Krt28 T C 11: 99,257,839 (GRCm39) E334G probably damaging Het
Lrrc75a T A 11: 62,496,921 (GRCm39) T214S probably damaging Het
Lyar A G 5: 38,385,202 (GRCm39) I81V probably benign Het
Mon2 A T 10: 122,871,998 (GRCm39) L342Q probably damaging Het
Mug2 C T 6: 122,024,401 (GRCm39) A491V probably damaging Het
Myh2 A G 11: 67,077,438 (GRCm39) T858A probably benign Het
Net1 C T 13: 3,936,074 (GRCm39) probably null Het
Or52s1 T A 7: 102,861,111 (GRCm39) Y4N probably benign Het
Or5p76 T C 7: 108,122,423 (GRCm39) T245A probably benign Het
Platr25 A T 13: 62,821,623 (GRCm39) I110N possibly damaging Het
Plk5 T A 10: 80,198,879 (GRCm39) L412H probably damaging Het
Rasal1 A T 5: 120,812,790 (GRCm39) T605S probably benign Het
Ryr2 T A 13: 11,683,707 (GRCm39) D3119V probably damaging Het
Serpina1a G T 12: 103,820,017 (GRCm39) H387N probably benign Het
Serpina1d G T 12: 103,733,811 (GRCm39) N164K probably damaging Het
Smurf1 A G 5: 144,836,307 (GRCm39) Y69H probably damaging Het
Sod2 A G 17: 13,227,250 (GRCm39) K68R probably benign Het
Ssbp2 A G 13: 91,687,470 (GRCm39) N51S possibly damaging Het
Tcl1b1 A G 12: 105,130,663 (GRCm39) R49G probably benign Het
Tln1 A G 4: 43,547,525 (GRCm39) I812T probably damaging Het
Topaz1 T A 9: 122,577,419 (GRCm39) C110S possibly damaging Het
Ubap2l A G 3: 89,930,867 (GRCm39) F393L probably damaging Het
Vmn1r62 G A 7: 5,678,769 (GRCm39) G150D probably damaging Het
Wdr24 C A 17: 26,046,899 (GRCm39) Q651K probably damaging Het
Wdr7 A G 18: 63,911,322 (GRCm39) T905A possibly damaging Het
Zfyve26 A G 12: 79,285,109 (GRCm39) F2382S probably damaging Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25,387,442 (GRCm39) missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25,403,621 (GRCm39) missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25,396,343 (GRCm39) missense probably benign
R0004:Tgfb1 UTSW 7 25,391,791 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0470:Tgfb1 UTSW 7 25,387,355 (GRCm39) unclassified probably benign
R1872:Tgfb1 UTSW 7 25,391,891 (GRCm39) missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25,404,234 (GRCm39) missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25,396,655 (GRCm39) missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25,387,574 (GRCm39) missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25,393,706 (GRCm39) missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25,396,385 (GRCm39) missense probably benign 0.00
R6727:Tgfb1 UTSW 7 25,388,587 (GRCm39) unclassified probably benign
R7203:Tgfb1 UTSW 7 25,391,964 (GRCm39) critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25,404,263 (GRCm39) missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25,387,120 (GRCm39) unclassified probably benign
R8257:Tgfb1 UTSW 7 25,396,373 (GRCm39) missense probably damaging 0.97
R9124:Tgfb1 UTSW 7 25,388,580 (GRCm39) nonsense probably null
R9418:Tgfb1 UTSW 7 25,391,952 (GRCm39) missense probably damaging 1.00
Z1177:Tgfb1 UTSW 7 25,387,633 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGTTTGAGCTGAGCCCTG -3'
(R):5'- TTCATGTCATGGATGGTGCC -3'

Sequencing Primer
(F):5'- TTTGAGCTGAGCCCTGAATAAG -3'
(R):5'- TTGTGGTGAAGGACATACACACAC -3'
Posted On 2018-06-06