Mutagenetix > Incidental Mutation

Incidental Mutation 'R6548:Zfyve26'

521393

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, 9330197E15Rik, LOC380767

MMRRC Submission

044673-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6548 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79279120-79343078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79285109 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 2382 (F2382S)

Ref Sequence

ENSEMBL: ENSMUSP00000021547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably damaging
Transcript: ENSMUST00000021547
AA Change: F2382S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: F2382S

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219105

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220390

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

93% (38/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030612E09Rik	T	C	10: 43,050,769 (GRCm39)	L21P	probably damaging	Het
Ank3	C	T	10: 69,728,240 (GRCm39)	A642V	probably damaging	Het
Bap1	A	G	14: 30,978,182 (GRCm39)	N349S	probably benign	Het
Brca1	G	T	11: 101,415,591 (GRCm39)	Q32K	probably damaging	Het
Ccdc39	A	T	3: 33,892,108 (GRCm39)	N121K	probably benign	Het
Champ1	A	T	8: 13,930,002 (GRCm39)	N720I	probably damaging	Het
Chd3	T	A	11: 69,252,886 (GRCm39)	R216*	probably null	Het
D630003M21Rik	A	G	2: 158,047,619 (GRCm39)		probably null	Het
Exoc2	A	T	13: 31,010,047 (GRCm39)	V804E	possibly damaging	Het
Fcgbp	A	G	7: 27,791,343 (GRCm39)	N868S	probably benign	Het
Gm10376	T	C	14: 42,873,025 (GRCm39)	M1V	probably null	Het
Gpc2	G	A	5: 138,275,533 (GRCm39)		probably null	Het
Gpr37	G	A	6: 25,688,812 (GRCm39)	T95I	probably benign	Het
Ints3	G	A	3: 90,299,431 (GRCm39)		probably benign	Het
Krt28	T	C	11: 99,257,839 (GRCm39)	E334G	probably damaging	Het
Lrrc75a	T	A	11: 62,496,921 (GRCm39)	T214S	probably damaging	Het
Lyar	A	G	5: 38,385,202 (GRCm39)	I81V	probably benign	Het
Mon2	A	T	10: 122,871,998 (GRCm39)	L342Q	probably damaging	Het
Mug2	C	T	6: 122,024,401 (GRCm39)	A491V	probably damaging	Het
Myh2	A	G	11: 67,077,438 (GRCm39)	T858A	probably benign	Het
Net1	C	T	13: 3,936,074 (GRCm39)		probably null	Het
Or52s1	T	A	7: 102,861,111 (GRCm39)	Y4N	probably benign	Het
Or5p76	T	C	7: 108,122,423 (GRCm39)	T245A	probably benign	Het
Platr25	A	T	13: 62,821,623 (GRCm39)	I110N	possibly damaging	Het
Plk5	T	A	10: 80,198,879 (GRCm39)	L412H	probably damaging	Het
Rasal1	A	T	5: 120,812,790 (GRCm39)	T605S	probably benign	Het
Ryr2	T	A	13: 11,683,707 (GRCm39)	D3119V	probably damaging	Het
Serpina1a	G	T	12: 103,820,017 (GRCm39)	H387N	probably benign	Het
Serpina1d	G	T	12: 103,733,811 (GRCm39)	N164K	probably damaging	Het
Smurf1	A	G	5: 144,836,307 (GRCm39)	Y69H	probably damaging	Het
Sod2	A	G	17: 13,227,250 (GRCm39)	K68R	probably benign	Het
Ssbp2	A	G	13: 91,687,470 (GRCm39)	N51S	possibly damaging	Het
Tcl1b1	A	G	12: 105,130,663 (GRCm39)	R49G	probably benign	Het
Tgfb1	A	G	7: 25,396,350 (GRCm39)	I214M	probably benign	Het
Tln1	A	G	4: 43,547,525 (GRCm39)	I812T	probably damaging	Het
Topaz1	T	A	9: 122,577,419 (GRCm39)	C110S	possibly damaging	Het
Ubap2l	A	G	3: 89,930,867 (GRCm39)	F393L	probably damaging	Het
Vmn1r62	G	A	7: 5,678,769 (GRCm39)	G150D	probably damaging	Het
Wdr24	C	A	17: 26,046,899 (GRCm39)	Q651K	probably damaging	Het
Wdr7	A	G	18: 63,911,322 (GRCm39)	T905A	possibly damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79,296,234 (GRCm39)	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79,327,674 (GRCm39)	missense	probably benign
IGL01148:Zfyve26	APN	12	79,307,644 (GRCm39)	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79,298,957 (GRCm39)	splice site	probably null
IGL01472:Zfyve26	APN	12	79,323,117 (GRCm39)	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79,291,147 (GRCm39)	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79,334,625 (GRCm39)	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79,308,348 (GRCm39)	splice site	probably null
IGL01689:Zfyve26	APN	12	79,330,827 (GRCm39)	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79,334,218 (GRCm39)	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79,291,174 (GRCm39)	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79,323,169 (GRCm39)	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79,315,621 (GRCm39)	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79,326,854 (GRCm39)	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79,285,794 (GRCm39)	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79,310,644 (GRCm39)	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79,308,565 (GRCm39)	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79,342,338 (GRCm39)	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79,330,846 (GRCm39)	nonsense	probably null
challenge	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
fourteener	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79,320,084 (GRCm39)	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79,323,055 (GRCm39)	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79,291,258 (GRCm39)	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79,292,996 (GRCm39)	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79,315,502 (GRCm39)	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79,312,576 (GRCm39)	splice site	probably benign
R0738:Zfyve26	UTSW	12	79,342,308 (GRCm39)	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79,320,372 (GRCm39)	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79,318,901 (GRCm39)	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79,310,723 (GRCm39)	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79,321,694 (GRCm39)	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79,329,591 (GRCm39)	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79,298,937 (GRCm39)	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79,298,925 (GRCm39)	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79,334,535 (GRCm39)	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79,285,718 (GRCm39)	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79,325,237 (GRCm39)	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79,315,823 (GRCm39)	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79,333,032 (GRCm39)	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79,311,125 (GRCm39)	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79,286,744 (GRCm39)	nonsense	probably null
R1982:Zfyve26	UTSW	12	79,302,017 (GRCm39)	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79,330,806 (GRCm39)	splice site	probably null
R2071:Zfyve26	UTSW	12	79,334,220 (GRCm39)	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79,292,826 (GRCm39)	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79,292,861 (GRCm39)	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79,321,814 (GRCm39)	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79,330,890 (GRCm39)	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79,329,573 (GRCm39)	splice site	probably null
R3084:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R3086:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R4626:Zfyve26	UTSW	12	79,315,844 (GRCm39)	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79,291,170 (GRCm39)	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79,296,469 (GRCm39)	splice site	probably null
R4926:Zfyve26	UTSW	12	79,321,785 (GRCm39)	missense	probably benign
R4990:Zfyve26	UTSW	12	79,334,607 (GRCm39)	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79,327,159 (GRCm39)	nonsense	probably null
R5029:Zfyve26	UTSW	12	79,333,097 (GRCm39)	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79,302,135 (GRCm39)	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79,326,832 (GRCm39)	nonsense	probably null
R5252:Zfyve26	UTSW	12	79,315,756 (GRCm39)	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79,317,624 (GRCm39)	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79,293,295 (GRCm39)	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79,286,698 (GRCm39)	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79,320,147 (GRCm39)	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79,311,131 (GRCm39)	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79,334,511 (GRCm39)	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79,313,311 (GRCm39)	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79,340,628 (GRCm39)	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79,315,501 (GRCm39)	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79,296,373 (GRCm39)	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79,286,776 (GRCm39)	missense	probably damaging	0.97
R6887:Zfyve26	UTSW	12	79,313,223 (GRCm39)	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79,330,926 (GRCm39)	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79,325,888 (GRCm39)	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79,327,179 (GRCm39)	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79,315,182 (GRCm39)	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79,292,945 (GRCm39)	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79,325,146 (GRCm39)	splice site	probably null
R7299:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79,297,942 (GRCm39)	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79,286,828 (GRCm39)	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79,334,581 (GRCm39)	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79,315,450 (GRCm39)	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79,337,731 (GRCm39)	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79,315,409 (GRCm39)	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79,327,129 (GRCm39)	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79,302,098 (GRCm39)	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79,315,331 (GRCm39)	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79,327,610 (GRCm39)	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79,307,605 (GRCm39)	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79,334,454 (GRCm39)	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79,334,227 (GRCm39)	missense	probably benign
R8758:Zfyve26	UTSW	12	79,311,083 (GRCm39)	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79,285,742 (GRCm39)	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79,334,152 (GRCm39)	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79,318,915 (GRCm39)	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79,311,168 (GRCm39)	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79,323,076 (GRCm39)	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79,321,680 (GRCm39)	nonsense	probably null
R9348:Zfyve26	UTSW	12	79,315,231 (GRCm39)	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79,291,239 (GRCm39)	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79,298,046 (GRCm39)	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79,334,418 (GRCm39)	missense	probably benign
R9676:Zfyve26	UTSW	12	79,330,959 (GRCm39)	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79,293,006 (GRCm39)	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79,302,112 (GRCm39)	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79,285,779 (GRCm39)	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79,315,307 (GRCm39)	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79,334,149 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCATTTGACCCAGTTCTG -3'
(R):5'- GTTAGCCCAGTTGAAATTATCTGG -3'

Sequencing Primer
(F):5'- GGCATTTGACCCAGTTCTGTATCAC -3'
(R):5'- TTCAAGGCCAGCATGATCTG -3'

Posted On

2018-06-06