Incidental Mutation 'R6549:Sell'
ID521423
Institutional Source Beutler Lab
Gene Symbol Sell
Ensembl Gene ENSMUSG00000026581
Gene Nameselectin, lymphocyte
SynonymsLyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6549 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164061982-164084181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164065629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 138 (D138G)
Ref Sequence ENSEMBL: ENSMUSP00000142237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027871] [ENSMUST00000097491] [ENSMUST00000192047] [ENSMUST00000195358]
Predicted Effect probably damaging
Transcript: ENSMUST00000027871
AA Change: D138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581
AA Change: D138G

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097491
AA Change: D138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581
AA Change: D138G

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192047
AA Change: D138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581
AA Change: D138G

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195358
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Fam126b T C 1: 58,539,600 I264V probably benign Het
Gm9922 C A 14: 101,729,457 probably benign Het
Ldb3 A G 14: 34,541,897 M545T probably damaging Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y probably benign Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Pus10 G A 11: 23,729,075 probably null Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn1r31 A T 6: 58,472,663 N72K possibly damaging Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Zfp988 G A 4: 147,331,853 C248Y probably benign Het
Other mutations in Sell
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum UTSW 1 164066201 unclassified probably null
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 unclassified probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R3848:Sell UTSW 1 164065661 nonsense probably null
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4671:Sell UTSW 1 164065473 missense probably damaging 1.00
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R5112:Sell UTSW 1 164065318 missense possibly damaging 0.75
R7148:Sell UTSW 1 164065607 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTAGTCGCCATACAAAACAAGAGAG -3'
(R):5'- ATTGCCCAGAGGTGCTATGC -3'

Sequencing Primer
(F):5'- TTTAGAGAATACATTGCCCAAAAGCC -3'
(R):5'- CCCAGAGGTGCTATGCTTAAG -3'
Posted On2018-06-06