Incidental Mutation 'R6549:Zfp988'
ID521431
Institutional Source Beutler Lab
Gene Symbol Zfp988
Ensembl Gene ENSMUSG00000078498
Gene Namezinc finger protein 988
SynonymsGm13151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6549 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location147305674-147333734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147331853 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 248 (C248Y)
Ref Sequence ENSEMBL: ENSMUSP00000120413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148762] [ENSMUST00000166764]
Predicted Effect probably benign
Transcript: ENSMUST00000148762
AA Change: C248Y

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120413
Gene: ENSMUSG00000078498
AA Change: C248Y

DomainStartEndE-ValueType
KRAB 13 76 4.74e-16 SMART
ZnF_C2H2 240 262 2.61e-4 SMART
ZnF_C2H2 268 290 1.3e-4 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 7.78e-3 SMART
ZnF_C2H2 352 374 1.3e-4 SMART
ZnF_C2H2 380 402 8.34e-3 SMART
ZnF_C2H2 408 430 2.79e-4 SMART
ZnF_C2H2 436 458 3.74e-5 SMART
ZnF_C2H2 464 486 1.3e-4 SMART
ZnF_C2H2 492 514 1.5e-4 SMART
ZnF_C2H2 520 542 2.43e-4 SMART
ZnF_C2H2 548 570 9.73e-4 SMART
ZnF_C2H2 576 598 1.56e-2 SMART
ZnF_C2H2 604 626 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181752
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Fam126b T C 1: 58,539,600 I264V probably benign Het
Gm9922 C A 14: 101,729,457 probably benign Het
Ldb3 A G 14: 34,541,897 M545T probably damaging Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y probably benign Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Pus10 G A 11: 23,729,075 probably null Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Sell A G 1: 164,065,629 D138G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn1r31 A T 6: 58,472,663 N72K possibly damaging Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Other mutations in Zfp988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zfp988 APN 4 147331668 nonsense probably null
R1672:Zfp988 UTSW 4 147331282 missense probably benign
R1834:Zfp988 UTSW 4 147332887 missense probably damaging 0.97
R2324:Zfp988 UTSW 4 147332785 missense probably benign
R2380:Zfp988 UTSW 4 147332785 missense probably benign
R3795:Zfp988 UTSW 4 147331583 missense possibly damaging 0.51
R3945:Zfp988 UTSW 4 147332785 missense probably benign
R4024:Zfp988 UTSW 4 147332785 missense probably benign
R5012:Zfp988 UTSW 4 147331603 missense probably benign
R5059:Zfp988 UTSW 4 147331915 nonsense probably null
R6008:Zfp988 UTSW 4 147331802 missense probably benign 0.16
R6245:Zfp988 UTSW 4 147332013 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGAACACTAAAGAAGTTTGC -3'
(R):5'- GGTAAAGCATTTGTCACATTCACTG -3'

Sequencing Primer
(F):5'- GTCTCAATCAAGGAATTAACATGCAG -3'
(R):5'- GTCACATTCACTGCATTTGTAAGG -3'
Posted On2018-06-06