Incidental Mutation 'R6549:Ldb3'
ID521459
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene NameLIM domain binding 3
Synonymscypher, ZASP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6549 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34526603-34588682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34541897 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 545 (M545T)
Ref Sequence ENSEMBL: ENSMUSP00000154758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000228044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022327
AA Change: M646T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798
AA Change: M646T

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022328
AA Change: M584T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798
AA Change: M584T

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064098
AA Change: M602T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798
AA Change: M602T

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090040
AA Change: M607T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798
AA Change: M607T

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228044
AA Change: M545T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Fam126b T C 1: 58,539,600 I264V probably benign Het
Gm9922 C A 14: 101,729,457 probably benign Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y probably benign Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Pus10 G A 11: 23,729,075 probably null Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Sell A G 1: 164,065,629 D138G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn1r31 A T 6: 58,472,663 N72K possibly damaging Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Zfp988 G A 4: 147,331,853 C248Y probably benign Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R2865:Ldb3 UTSW 14 34529503 missense probably damaging 1.00
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3765:Ldb3 UTSW 14 34578682 splice site probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R4963:Ldb3 UTSW 14 34566858 missense probably damaging 0.98
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6682:Ldb3 UTSW 14 34552264 missense possibly damaging 0.77
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7132:Ldb3 UTSW 14 34577035 missense probably benign 0.25
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCCTTCACAGTAGGATG -3'
(R):5'- AGTTTGCCTCATAGCCTGC -3'

Sequencing Primer
(F):5'- TAGGATGTGAATGGATGCAGGC -3'
(R):5'- CCTAGGTTACTTGGGCAGCAG -3'
Posted On2018-06-06