Incidental Mutation 'R6523:Ddx58'
ID521470
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40205947 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 882 (T882S)
Ref Sequence ENSEMBL: ENSMUSP00000042433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
PDB Structure
Mouse RIG-I ATPase Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000037907
AA Change: T882S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: T882S

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140616
Predicted Effect probably benign
Transcript: ENSMUST00000142055
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGGCTCATCAACTCCATGC -3'
(R):5'- CCCGTTTCTAACATTGTGCG -3'

Sequencing Primer
(F):5'- GGCTCATCAACTCCATGCTTAAGG -3'
(R):5'- AACATTGTGCGCTCCATCTC -3'
Posted On2018-06-06