Incidental Mutation 'R6523:Ccdc28b'
ID521476
Institutional Source Beutler Lab
Gene Symbol Ccdc28b
Ensembl Gene ENSMUSG00000028795
Gene Namecoiled coil domain containing 28B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129619274-129623947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129620987 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 110 (F110V)
Ref Sequence ENSEMBL: ENSMUSP00000122229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030586] [ENSMUST00000046675] [ENSMUST00000106035] [ENSMUST00000121442] [ENSMUST00000137090] [ENSMUST00000150357] [ENSMUST00000151838] [ENSMUST00000174073]
Predicted Effect probably damaging
Transcript: ENSMUST00000030586
AA Change: F110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030586
Gene: ENSMUSG00000028795
AA Change: F110V

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 185 4.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046675
SMART Domains Protein: ENSMUSP00000040584
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
low complexity region 150 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106035
AA Change: F110V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101652
Gene: ENSMUSG00000028795
AA Change: F110V

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 86 178 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121442
SMART Domains Protein: ENSMUSP00000113036
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131559
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146378
Predicted Effect probably benign
Transcript: ENSMUST00000150357
SMART Domains Protein: ENSMUSP00000118241
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 104 7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151838
AA Change: F110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122229
Gene: ENSMUSG00000028795
AA Change: F110V

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 120 1.1e-13 PFAM
low complexity region 132 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152708
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene localizes to centrosomes and basal bodies. The protein colocalizes with several proteins associated with Bardet-Biedl syndrome (BBS) and participates in the regulation of cilia development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Ccdc28b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4362001:Ccdc28b UTSW 4 129621025 missense probably benign 0.00
R0722:Ccdc28b UTSW 4 129621152 critical splice acceptor site probably null
R1172:Ccdc28b UTSW 4 129620889 intron probably benign
R1440:Ccdc28b UTSW 4 129620615 missense probably benign
R1842:Ccdc28b UTSW 4 129621013 missense probably damaging 1.00
R2475:Ccdc28b UTSW 4 129620652 unclassified probably null
R5396:Ccdc28b UTSW 4 129619445 missense probably damaging 0.99
R7125:Ccdc28b UTSW 4 129621092 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACACATCCAGGCTGAAGTGC -3'
(R):5'- AGAGAGACATGACACACCTATG -3'

Sequencing Primer
(F):5'- AAGTGCAGTCTGGCCAACTTC -3'
(R):5'- AGTCATGTCTACTTTACCCAGAGCAG -3'
Posted On2018-06-06