Incidental Mutation 'R6550:Hsh2d'
ID521512
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72198453 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 156 (T156K)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: T156K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: T156K

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: T156K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: T156K

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Meta Mutation Damage Score 0.1548 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCGCTCTGTTTAGGAGACC -3'
(R):5'- TCAGAGTCTGGAAGTCACTGG -3'

Sequencing Primer
(F):5'- TGTTTAGGAGACCCCCTACC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2018-06-06