Incidental Mutation 'R6523:Slc1a4'
ID521513
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Namesolute carrier family 1 (glutamate/neutral amino acid transporter), member 4
SynonymsASCT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6523 (G1)
Quality Score119.008
Status Validated
Chromosome11
Chromosomal Location20302180-20332713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20332114 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 40 (Y40F)
Ref Sequence ENSEMBL: ENSMUSP00000004634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
Predicted Effect probably damaging
Transcript: ENSMUST00000004634
AA Change: Y40F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142
AA Change: Y40F

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109594
AA Change: Y120F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142
AA Change: Y120F

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180654
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20308644 splice site probably benign
IGL01889:Slc1a4 APN 11 20314089 splice site probably benign
IGL02725:Slc1a4 APN 11 20308408 missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20306506 missense probably damaging 1.00
R0085:Slc1a4 UTSW 11 20304510 splice site probably benign
R0771:Slc1a4 UTSW 11 20306467 missense probably damaging 1.00
R0898:Slc1a4 UTSW 11 20304349 missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20332159 missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20304375 missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20332620 start gained probably benign
R3498:Slc1a4 UTSW 11 20313973 missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20304348 missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20308452 missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20304384 missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20332166 missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20304417 missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20304429 missense possibly damaging 0.68
R6863:Slc1a4 UTSW 11 20314001 missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20304346 missense probably damaging 1.00
X0025:Slc1a4 UTSW 11 20318703 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTACCTGAGTAAATCGAG -3'
(R):5'- TTGAGTGTTACCGCTTAGAGC -3'

Sequencing Primer
(F):5'- TACCTGAGTAAATCGAGGAAAGAGTC -3'
(R):5'- AAATCGCAGCGCTGTGC -3'
Posted On2018-06-06