Incidental Mutation 'R6550:Polrmt'
ID521523
Institutional Source Beutler Lab
Gene Symbol Polrmt
Ensembl Gene ENSMUSG00000020329
Gene Namepolymerase (RNA) mitochondrial (DNA directed)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79736123-79746581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79739680 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 672 (Q672H)
Ref Sequence ENSEMBL: ENSMUSP00000124556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000020581] [ENSMUST00000099513] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably damaging
Transcript: ENSMUST00000020580
AA Change: Q672H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329
AA Change: Q672H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020581
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099513
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159016
AA Change: Q598H

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329
AA Change: Q598H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161375
Predicted Effect probably benign
Transcript: ENSMUST00000161662
SMART Domains Protein: ENSMUSP00000124230
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
Pfam:RNA_pol 29 120 6.7e-39 PFAM
Pfam:RNA_pol 119 393 2.7e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162687
Predicted Effect probably damaging
Transcript: ENSMUST00000162694
AA Change: Q672H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329
AA Change: Q672H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die before organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Polrmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Polrmt APN 10 79737597 splice site probably null
IGL01145:Polrmt APN 10 79741137 missense probably benign 0.12
IGL01454:Polrmt APN 10 79743683 missense possibly damaging 0.60
IGL01511:Polrmt APN 10 79740151 missense probably benign 0.00
IGL01750:Polrmt APN 10 79739846 missense possibly damaging 0.84
IGL01766:Polrmt APN 10 79736568 missense possibly damaging 0.71
IGL01827:Polrmt APN 10 79738120 missense probably damaging 1.00
IGL02941:Polrmt APN 10 79737258 splice site probably benign
IGL02982:Polrmt APN 10 79738348 missense probably damaging 1.00
R0323:Polrmt UTSW 10 79741998 missense probably benign 0.41
R0379:Polrmt UTSW 10 79737611 missense possibly damaging 0.89
R0628:Polrmt UTSW 10 79739145 missense possibly damaging 0.89
R1017:Polrmt UTSW 10 79743509 nonsense probably null
R1846:Polrmt UTSW 10 79738209 missense probably damaging 1.00
R2082:Polrmt UTSW 10 79743512 missense probably benign 0.41
R2149:Polrmt UTSW 10 79740275 nonsense probably null
R2359:Polrmt UTSW 10 79736562 missense probably damaging 1.00
R4105:Polrmt UTSW 10 79741733 missense probably benign
R4381:Polrmt UTSW 10 79741808 missense possibly damaging 0.94
R4782:Polrmt UTSW 10 79739523 missense probably benign 0.04
R4902:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4904:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4916:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4938:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4963:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4964:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4970:Polrmt UTSW 10 79736587 missense probably damaging 1.00
R5177:Polrmt UTSW 10 79737476 missense probably benign 0.04
R5484:Polrmt UTSW 10 79742054 missense probably damaging 1.00
R5820:Polrmt UTSW 10 79738323 splice site probably null
R5910:Polrmt UTSW 10 79743497 missense probably benign 0.03
R5928:Polrmt UTSW 10 79740352 missense probably damaging 1.00
R6979:Polrmt UTSW 10 79746566 utr 5 prime probably null
R7323:Polrmt UTSW 10 79740649 missense probably benign
X0026:Polrmt UTSW 10 79740740 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCCGCAGCTCAGACTTGTG -3'
(R):5'- TTCACGCACCTGCTAGAGAC -3'

Sequencing Primer
(F):5'- AGCTCAGACTTGTGCACTG -3'
(R):5'- TGACCTTCGAGACCACGGAAG -3'
Posted On2018-06-06