Incidental Mutation 'R6523:Krt14'
ID521524
Institutional Source Beutler Lab
Gene Symbol Krt14
Ensembl Gene ENSMUSG00000045545
Gene Namekeratin 14
SynonymsKrt1-14, K14, Cytokeratin 14, Krt-1.14, epidermolysis bullosa simplex, Dowling-Meara, Koebner
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100203162-100207548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100205097 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 212 (T212A)
Ref Sequence ENSEMBL: ENSMUSP00000007272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007272
AA Change: T212A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007272
Gene: ENSMUSG00000045545
AA Change: T212A

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 120 431 5.67e-176 SMART
low complexity region 433 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137265
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations develop extensive skin blistering after birth and die by 2 days of age. If keratin 16 is also expressed in skin, development is normal but later alopecia, chronic skin ulcers and stratified epithelial defects occur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Krt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Krt14 APN 11 100204416 splice site probably benign
R0449:Krt14 UTSW 11 100207395 missense unknown
R0848:Krt14 UTSW 11 100204264 missense probably damaging 1.00
R1302:Krt14 UTSW 11 100203347 missense probably damaging 1.00
R2024:Krt14 UTSW 11 100207218 missense unknown
R2088:Krt14 UTSW 11 100204123 missense possibly damaging 0.81
R2161:Krt14 UTSW 11 100207113 missense unknown
R3878:Krt14 UTSW 11 100207089 missense possibly damaging 0.56
R5015:Krt14 UTSW 11 100207206 nonsense probably null
R5314:Krt14 UTSW 11 100204700 missense probably damaging 1.00
R5474:Krt14 UTSW 11 100204745 missense probably damaging 1.00
R5698:Krt14 UTSW 11 100205625 missense probably benign 0.44
R5707:Krt14 UTSW 11 100204758 missense possibly damaging 0.77
R6072:Krt14 UTSW 11 100207166 missense unknown
R6622:Krt14 UTSW 11 100203960 missense probably benign 0.00
R7082:Krt14 UTSW 11 100203341 missense possibly damaging 0.95
R7239:Krt14 UTSW 11 100204255 missense probably benign 0.03
R7350:Krt14 UTSW 11 100205100 nonsense probably null
X0020:Krt14 UTSW 11 100205106 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATCCACCCTCTTAAGCTGG -3'
(R):5'- AAGCTGGAAGTGCCTCTTTC -3'

Sequencing Primer
(F):5'- AAGCTGGCTTTTCCACCTAG -3'
(R):5'- CTCTTTCAGGCACATGACTAAGGG -3'
Posted On2018-06-06