Incidental Mutation 'R6523:Sacs'
ID521549
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61202961 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 819 (L819I)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: L819I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: L819I

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAATCCAGAGCGATTTGC -3'
(R):5'- TGCAAAATAGCACTCGGGAG -3'

Sequencing Primer
(F):5'- GAAGTCATGAATACATTCTGGCCTGG -3'
(R):5'- CTCGGGAGTGGGGAATGAATG -3'
Posted On2018-06-06