Incidental Mutation 'R6523:Rhot2'
ID521561
Institutional Source Beutler Lab
Gene Symbol Rhot2
Ensembl Gene ENSMUSG00000025733
Gene Nameras homolog family member T2
SynonymsMiro2, Arht2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6523 (G1)
Quality Score200.009
Status Validated
Chromosome17
Chromosomal Location25838457-25844851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25839420 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000043897] [ENSMUST00000176709] [ENSMUST00000183929] [ENSMUST00000184865]
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000043897
AA Change: V604A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733
AA Change: V604A

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176583
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176604
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176751
AA Change: V393A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of GTPases. The encoded protein is localized to the outer mitochondrial membrane and plays a role in mitochondrial trafficking and fusion-fission dynamics. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal mitochondria distribution in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Rhot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Rhot2 APN 17 25841360 critical splice donor site probably null
IGL02707:Rhot2 APN 17 25844296 missense probably damaging 1.00
IGL03087:Rhot2 APN 17 25841141 unclassified probably benign
Endless UTSW 17 25840912 missense probably damaging 1.00
ewige UTSW 17 25839420 missense possibly damaging 0.69
R0634:Rhot2 UTSW 17 25842028 missense possibly damaging 0.71
R1233:Rhot2 UTSW 17 25844097 missense probably damaging 1.00
R1436:Rhot2 UTSW 17 25841400 missense probably benign 0.16
R2902:Rhot2 UTSW 17 25843976 missense probably damaging 0.99
R3617:Rhot2 UTSW 17 25840981 unclassified probably benign
R3767:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3768:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3769:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3770:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R4362:Rhot2 UTSW 17 25842091 missense probably damaging 1.00
R4487:Rhot2 UTSW 17 25839493 missense probably benign 0.01
R4670:Rhot2 UTSW 17 25841331 unclassified probably benign
R4749:Rhot2 UTSW 17 25844274 missense probably damaging 1.00
R5772:Rhot2 UTSW 17 25839807 missense probably benign 0.00
R5840:Rhot2 UTSW 17 25840058 missense probably benign
R5993:Rhot2 UTSW 17 25841111 missense probably benign 0.45
R6479:Rhot2 UTSW 17 25841080 missense probably benign 0.22
R6597:Rhot2 UTSW 17 25840912 missense probably damaging 1.00
R7269:Rhot2 UTSW 17 25842428 splice site probably null
R7427:Rhot2 UTSW 17 25841609 missense probably damaging 1.00
R7479:Rhot2 UTSW 17 25840749 missense probably damaging 1.00
X0067:Rhot2 UTSW 17 25841466 missense possibly damaging 0.84
Y5409:Rhot2 UTSW 17 25844295 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCAGCCACACAGATATTAC -3'
(R):5'- TGTCTGGGTACAAAGGTGTCAG -3'

Sequencing Primer
(F):5'- AGATATTACTCCAACAGGCCG -3'
(R):5'- CCCAGAGAGCTATGCTGGATG -3'
Posted On2018-06-06