Mutagenetix > Incidental Mutation

Incidental Mutation 'R6551:Pik3c2a'

521620

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

044676-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6551 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115936500-116042684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116016731 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 342 (I342N)

Ref Sequence

ENSEMBL: ENSMUSP00000145572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: I342N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: I342N

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000205378
AA Change: I342N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205767

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: I342N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	T	1: 192,856,831 (GRCm39)	Q61L	probably damaging	Het
Acss2	T	C	2: 155,393,128 (GRCm39)	S285P	probably benign	Het
Ager	A	G	17: 34,818,442 (GRCm39)		probably null	Het
Alkbh7	T	A	17: 57,305,945 (GRCm39)	Y115*	probably null	Het
Brwd1	T	C	16: 95,795,162 (GRCm39)	D2184G	possibly damaging	Het
Chp1	T	A	2: 119,402,294 (GRCm39)	H89Q	possibly damaging	Het
Clmp	T	C	9: 40,682,573 (GRCm39)	V119A	probably benign	Het
Cryge	A	T	1: 65,087,796 (GRCm39)	M171K	probably benign	Het
Cttnbp2nl	A	T	3: 104,912,433 (GRCm39)	S484T	possibly damaging	Het
Dsg3	C	A	18: 20,672,968 (GRCm39)	P880T	unknown	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Espn	T	C	4: 152,213,223 (GRCm39)			Het
Fbxo31	A	C	8: 122,291,443 (GRCm39)		probably benign	Het
Grin2b	A	G	6: 135,710,342 (GRCm39)	V1068A	probably damaging	Het
Jak1	C	A	4: 101,051,040 (GRCm39)		probably benign	Het
Klra10	A	T	6: 130,252,718 (GRCm39)	D185E	probably benign	Het
Lhx1	A	C	11: 84,412,739 (GRCm39)	D60E	probably benign	Het
Lyar	C	A	5: 38,390,616 (GRCm39)	A326D	probably damaging	Het
Muc16	A	C	9: 18,473,858 (GRCm39)	S1280A	possibly damaging	Het
Nol9	G	A	4: 152,136,325 (GRCm39)	V466I	possibly damaging	Het
Or10d1	C	A	9: 39,483,856 (GRCm39)	R233L	probably benign	Het
Or12e8	T	C	2: 87,677,005 (GRCm39)	V130A	possibly damaging	Het
Or1e17	T	C	11: 73,831,129 (GRCm39)	I19T	probably benign	Het
Or1o1	G	A	17: 37,716,796 (GRCm39)	R119H	probably benign	Het
Or2w3b	A	T	11: 58,623,583 (GRCm39)	M136K	probably damaging	Het
Or2y10	G	T	11: 49,454,816 (GRCm39)	V23L	probably benign	Het
Pnldc1	A	G	17: 13,124,456 (GRCm39)	M133T	probably damaging	Het
Rab11fip1	G	A	8: 27,646,512 (GRCm39)	S188L	probably damaging	Het
Rapgef2	A	T	3: 79,122,342 (GRCm39)		probably null	Het
Rnf103	G	A	6: 71,487,349 (GRCm39)	C660Y	probably damaging	Het
Rph3al	G	A	11: 75,797,372 (GRCm39)	S108F	possibly damaging	Het
Srsf7	A	C	17: 80,511,648 (GRCm39)		probably benign	Het
Ssrp1	A	G	2: 84,871,450 (GRCm39)		probably null	Het
Tamm41	T	C	6: 114,989,142 (GRCm39)	D284G	possibly damaging	Het
Tmem161b	C	A	13: 84,370,537 (GRCm39)		probably benign	Het
Tmem39b	A	G	4: 129,585,896 (GRCm39)	V25A	probably benign	Het
Tmem88b	G	T	4: 155,870,149 (GRCm39)		probably benign	Het
Unk	T	C	11: 115,941,550 (GRCm39)	W266R	probably damaging	Het
Usp8	T	A	2: 126,575,102 (GRCm39)		probably benign	Het
Zbtb48	T	G	4: 152,106,678 (GRCm39)	Q142P	probably benign	Het
Zdhhc18	T	C	4: 133,340,960 (GRCm39)	T267A	probably benign	Het
Zfp335	G	A	2: 164,751,285 (GRCm39)	P94S	probably benign	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	115,963,735 (GRCm39)	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	115,973,038 (GRCm39)	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116,017,429 (GRCm39)	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	115,975,485 (GRCm39)	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	115,950,000 (GRCm39)	intron	probably benign
IGL01695:Pik3c2a	APN	7	116,016,753 (GRCm39)	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	115,945,423 (GRCm39)	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	115,950,039 (GRCm39)	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	115,987,299 (GRCm39)	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	115,962,575 (GRCm39)	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116,005,126 (GRCm39)	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	115,972,049 (GRCm39)	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	115,963,748 (GRCm39)	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116,017,256 (GRCm39)	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116,017,074 (GRCm39)	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	115,953,307 (GRCm39)	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	115,972,979 (GRCm39)	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	115,953,290 (GRCm39)	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	115,945,482 (GRCm39)	splice site	probably benign
R0991:Pik3c2a	UTSW	7	115,961,280 (GRCm39)	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	115,950,160 (GRCm39)	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116,016,908 (GRCm39)	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	115,987,300 (GRCm39)	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	115,987,280 (GRCm39)	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	115,968,083 (GRCm39)	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116,017,162 (GRCm39)	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116,017,755 (GRCm39)	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	115,945,471 (GRCm39)	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116,016,899 (GRCm39)	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	115,975,747 (GRCm39)	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	115,967,352 (GRCm39)	missense	probably benign
R1875:Pik3c2a	UTSW	7	116,017,206 (GRCm39)	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	115,953,241 (GRCm39)	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	115,941,472 (GRCm39)	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	115,963,738 (GRCm39)	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	115,950,057 (GRCm39)	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116,016,686 (GRCm39)	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	115,972,126 (GRCm39)	nonsense	probably null
R3814:Pik3c2a	UTSW	7	115,947,414 (GRCm39)	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	115,963,785 (GRCm39)	nonsense	probably null
R4386:Pik3c2a	UTSW	7	115,953,334 (GRCm39)	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	115,957,923 (GRCm39)	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116,017,060 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	115,947,509 (GRCm39)	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	115,941,636 (GRCm39)	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	115,950,021 (GRCm39)	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116,016,893 (GRCm39)	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116,005,186 (GRCm39)	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	115,967,419 (GRCm39)	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	115,961,799 (GRCm39)	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	115,947,440 (GRCm39)	missense	possibly damaging	0.46
R6641:Pik3c2a	UTSW	7	115,939,460 (GRCm39)	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	115,967,993 (GRCm39)	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	115,961,419 (GRCm39)	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	115,993,540 (GRCm39)	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116,017,223 (GRCm39)	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116,017,368 (GRCm39)	nonsense	probably null
R7153:Pik3c2a	UTSW	7	115,941,487 (GRCm39)	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	115,987,331 (GRCm39)	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	115,987,321 (GRCm39)	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116,005,178 (GRCm39)	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	115,973,074 (GRCm39)	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	115,975,621 (GRCm39)	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	115,953,242 (GRCm39)	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	115,972,089 (GRCm39)	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	115,993,474 (GRCm39)	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	115,939,331 (GRCm39)	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	115,987,312 (GRCm39)	nonsense	probably null
R7737:Pik3c2a	UTSW	7	115,955,488 (GRCm39)	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	115,993,529 (GRCm39)	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116,016,693 (GRCm39)	missense	probably benign
R7922:Pik3c2a	UTSW	7	115,990,517 (GRCm39)	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	115,949,350 (GRCm39)	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116,017,271 (GRCm39)	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	115,942,232 (GRCm39)	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116,017,283 (GRCm39)	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116,017,584 (GRCm39)	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	115,975,464 (GRCm39)	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	115,951,112 (GRCm39)	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116,017,659 (GRCm39)	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	115,987,320 (GRCm39)	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	115,993,531 (GRCm39)	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116,017,004 (GRCm39)	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116,017,115 (GRCm39)	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	115,945,413 (GRCm39)	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	115,990,558 (GRCm39)	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	115,961,289 (GRCm39)	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	115,939,321 (GRCm39)	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	115,957,939 (GRCm39)	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	115,945,427 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAATCTTTGCCACACAACAAAAGAA -3'
(R):5'- TTGGATCCTCTGAGTAAGCCT -3'

Sequencing Primer
(F):5'- GAACCAAAGCAGCCTAGAAGC -3'
(R):5'- TCCTCTGAGTAAGCCTAAGGTAGAC -3'

Posted On

2018-06-06