Incidental Mutation 'R6524:Dyrk1a'
ID 521627
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Name dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms 2310043O08Rik, Dyrk, D16Ertd272e, D16Ertd493e, Mnbh
MMRRC Submission 044650-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6524 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 94370869-94496376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94485979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 404 (S404L)
Ref Sequence ENSEMBL: ENSMUSP00000112853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284]
AlphaFold Q61214
Predicted Effect probably benign
Transcript: ENSMUST00000023614
AA Change: S442L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897
AA Change: S442L

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119878
AA Change: S442L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897
AA Change: S442L

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122284
AA Change: S404L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897
AA Change: S404L

DomainStartEndE-ValueType
low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,435,641 (GRCm39) R100G possibly damaging Het
Acin1 G T 14: 54,882,740 (GRCm39) D237E probably damaging Het
Ankfy1 G A 11: 72,621,308 (GRCm39) R198Q possibly damaging Het
C3 A T 17: 57,524,264 (GRCm39) probably null Het
Dnaaf2 A T 12: 69,237,159 (GRCm39) C650S probably benign Het
Dsg2 T G 18: 20,716,093 (GRCm39) F315V probably damaging Het
Eefsec T C 6: 88,274,902 (GRCm39) probably null Het
Esco1 T G 18: 10,582,188 (GRCm39) probably null Het
Fam83a T C 15: 57,858,736 (GRCm39) probably null Het
Fat3 A T 9: 15,903,552 (GRCm39) V2981E probably damaging Het
H1f11-ps G A 19: 47,158,999 (GRCm39) T192M unknown Het
Heatr5b A G 17: 79,121,535 (GRCm39) L730P possibly damaging Het
Hgsnat A G 8: 26,435,260 (GRCm39) S625P probably damaging Het
Itpr1 C T 6: 108,340,644 (GRCm39) T84I probably damaging Het
Itpr2 T C 6: 146,246,709 (GRCm39) N1070S probably benign Het
Itsn1 T C 16: 91,708,883 (GRCm39) F276L probably damaging Het
Krt84 A G 15: 101,441,187 (GRCm39) S2P unknown Het
Lbhd2 G A 12: 111,376,724 (GRCm39) R57H probably damaging Het
Lcmt2 T C 2: 120,969,412 (GRCm39) E337G possibly damaging Het
Lrp1b T C 2: 40,741,816 (GRCm39) E3037G possibly damaging Het
Lrp2 T C 2: 69,266,983 (GRCm39) E4308G possibly damaging Het
Med13 A G 11: 86,192,293 (GRCm39) I824T probably damaging Het
Meiob G A 17: 25,051,491 (GRCm39) V291I probably benign Het
Mtcl1 A T 17: 66,655,280 (GRCm39) D1343E probably benign Het
Mybl2 C A 2: 162,916,450 (GRCm39) P367Q possibly damaging Het
Nav3 T C 10: 109,555,891 (GRCm39) N1680S probably damaging Het
Nif3l1 T C 1: 58,496,999 (GRCm39) V308A probably benign Het
Or5h23 C T 16: 58,906,640 (GRCm39) V69M possibly damaging Het
Pclo G A 5: 14,768,883 (GRCm39) R4366H unknown Het
Phax T A 18: 56,720,074 (GRCm39) D338E probably damaging Het
Pnpla6 T A 8: 3,584,519 (GRCm39) probably null Het
Rint1 A T 5: 24,020,737 (GRCm39) M529L probably benign Het
Scand1 C T 2: 156,154,169 (GRCm39) probably benign Het
Six3 C T 17: 85,929,398 (GRCm39) T244I probably damaging Het
Slc4a4 T C 5: 89,380,623 (GRCm39) S1034P probably benign Het
Ssu72 T G 4: 155,799,997 (GRCm39) N53K probably null Het
Timm44 T C 8: 4,317,988 (GRCm39) D140G possibly damaging Het
Tspan8 T C 10: 115,679,984 (GRCm39) F200L probably benign Het
Tyw5 A T 1: 57,427,890 (GRCm39) V234D possibly damaging Het
Ubxn10 T A 4: 138,448,194 (GRCm39) R161* probably null Het
Vmn2r23 T A 6: 123,690,384 (GRCm39) L420Q probably damaging Het
Wdr1 A T 5: 38,687,406 (GRCm39) D208E probably benign Het
Yif1a A G 19: 5,142,204 (GRCm39) Y230C probably damaging Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94,485,943 (GRCm39) missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94,492,743 (GRCm39) missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94,460,476 (GRCm39) missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94,493,008 (GRCm39) missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94,472,221 (GRCm39) missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94,486,042 (GRCm39) missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94,486,102 (GRCm39) missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94,486,204 (GRCm39) splice site probably benign
R0414:Dyrk1a UTSW 16 94,464,701 (GRCm39) missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94,487,386 (GRCm39) missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94,485,991 (GRCm39) missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94,469,660 (GRCm39) splice site probably benign
R3125:Dyrk1a UTSW 16 94,469,660 (GRCm39) splice site probably benign
R3792:Dyrk1a UTSW 16 94,485,933 (GRCm39) missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94,464,605 (GRCm39) missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94,492,882 (GRCm39) missense possibly damaging 0.90
R4652:Dyrk1a UTSW 16 94,492,924 (GRCm39) missense probably benign 0.02
R4965:Dyrk1a UTSW 16 94,492,854 (GRCm39) nonsense probably null
R5326:Dyrk1a UTSW 16 94,487,440 (GRCm39) missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94,486,202 (GRCm39) critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94,460,442 (GRCm39) missense possibly damaging 0.64
R6313:Dyrk1a UTSW 16 94,460,373 (GRCm39) missense possibly damaging 0.95
R6396:Dyrk1a UTSW 16 94,472,299 (GRCm39) missense probably damaging 1.00
R7036:Dyrk1a UTSW 16 94,487,427 (GRCm39) missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94,492,902 (GRCm39) missense probably damaging 0.97
R7861:Dyrk1a UTSW 16 94,492,575 (GRCm39) nonsense probably null
R7916:Dyrk1a UTSW 16 94,474,200 (GRCm39) missense probably damaging 1.00
R8310:Dyrk1a UTSW 16 94,492,650 (GRCm39) missense probably benign 0.02
R8669:Dyrk1a UTSW 16 94,464,650 (GRCm39) missense probably damaging 1.00
R8698:Dyrk1a UTSW 16 94,487,414 (GRCm39) missense possibly damaging 0.77
R8920:Dyrk1a UTSW 16 94,460,488 (GRCm39) missense probably benign
R8945:Dyrk1a UTSW 16 94,466,866 (GRCm39) missense probably damaging 1.00
R9233:Dyrk1a UTSW 16 94,466,913 (GRCm39) missense probably benign 0.00
R9390:Dyrk1a UTSW 16 94,474,330 (GRCm39) missense probably damaging 1.00
R9391:Dyrk1a UTSW 16 94,460,373 (GRCm39) missense possibly damaging 0.95
RF010:Dyrk1a UTSW 16 94,478,422 (GRCm39) missense probably benign
Z1176:Dyrk1a UTSW 16 94,492,621 (GRCm39) missense probably benign 0.06
Z1177:Dyrk1a UTSW 16 94,492,439 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATGCTTAAGTGTTATGTGCAGAG -3'
(R):5'- AGACTGAGACTGCTCCATCG -3'

Sequencing Primer
(F):5'- GGGGTCTAGCTATTTTAATAACTGTC -3'
(R):5'- ATCGCAGGGCTGGTAGACAC -3'
Posted On 2018-06-06