Incidental Mutation 'R6524:Dsg2'
ID521641
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6524 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20583036 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 315 (F315V)
Ref Sequence ENSEMBL: ENSMUSP00000113153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: F315V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: F315V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120102
AA Change: F315V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: F315V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Pfam:Cadherin 282 347 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121837
SMART Domains Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,009 R100G possibly damaging Het
Acin1 G T 14: 54,645,283 D237E probably damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
C3 A T 17: 57,217,264 probably null Het
Dnaaf2 A T 12: 69,190,385 C650S probably benign Het
Dyrk1a C T 16: 94,685,120 S404L probably benign Het
Eefsec T C 6: 88,297,920 probably null Het
Esco1 T G 18: 10,582,188 probably null Het
Fam83a T C 15: 57,995,340 probably null Het
Fat3 A T 9: 15,992,256 V2981E probably damaging Het
Gm6970 G A 19: 47,170,560 T192M unknown Het
Heatr5b A G 17: 78,814,106 L730P possibly damaging Het
Hgsnat A G 8: 25,945,232 S625P probably damaging Het
Itpr1 C T 6: 108,363,683 T84I probably damaging Het
Itpr2 T C 6: 146,345,211 N1070S probably benign Het
Itsn1 T C 16: 91,911,995 F276L probably damaging Het
Krt84 A G 15: 101,532,752 S2P unknown Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 T C 2: 121,138,931 E337G possibly damaging Het
Lrp1b T C 2: 40,851,804 E3037G possibly damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Med13 A G 11: 86,301,467 I824T probably damaging Het
Meiob G A 17: 24,832,517 V291I probably benign Het
Mtcl1 A T 17: 66,348,285 D1343E probably benign Het
Mybl2 C A 2: 163,074,530 P367Q possibly damaging Het
Nav3 T C 10: 109,720,030 N1680S probably damaging Het
Nif3l1 T C 1: 58,457,840 V308A probably benign Het
Olfr191 C T 16: 59,086,277 V69M possibly damaging Het
Pclo G A 5: 14,718,869 R4366H unknown Het
Phax T A 18: 56,587,002 D338E probably damaging Het
Pnpla6 T A 8: 3,534,519 probably null Het
Rint1 A T 5: 23,815,739 M529L probably benign Het
Scand1 C T 2: 156,312,249 probably benign Het
Six3 C T 17: 85,621,970 T244I probably damaging Het
Slc4a4 T C 5: 89,232,764 S1034P probably benign Het
Ssu72 T G 4: 155,715,540 N53K probably null Het
Timm44 T C 8: 4,267,988 D140G possibly damaging Het
Tspan8 T C 10: 115,844,079 F200L probably benign Het
Tyw5 A T 1: 57,388,731 V234D possibly damaging Het
Ubxn10 T A 4: 138,720,883 R161* probably null Het
Vmn2r23 T A 6: 123,713,425 L420Q probably damaging Het
Wdr1 A T 5: 38,530,063 D208E probably benign Het
Yif1a A G 19: 5,092,176 Y230C probably damaging Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably null
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGCAAGCTCAAGTTCAGATCC -3'
(R):5'- AGCACCTGTGAGAGTATGGG -3'

Sequencing Primer
(F):5'- GCTCAAGTTCAGATCCGTATATTGG -3'
(R):5'- GGGACTCAAAGCATGTTAGTCTTTCC -3'
Posted On2018-06-06