Incidental Mutation 'R6525:Tns1'
ID521655
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R6525 (G1)
Quality Score158.009
Status Validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73953470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 683 (S683N)
Ref Sequence ENSEMBL: ENSMUSP00000148638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000191367] [ENSMUST00000212888]
Predicted Effect probably damaging
Transcript: ENSMUST00000169786
AA Change: S683N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: S683N

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185331
AA Change: S513N
Predicted Effect unknown
Transcript: ENSMUST00000185702
AA Change: S513N
Predicted Effect probably damaging
Transcript: ENSMUST00000187584
AA Change: S639N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: S639N

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191104
AA Change: S683N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: S683N

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191367
AA Change: S56N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212888
AA Change: S683N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam208b G A 13: 3,576,540 Q455* probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hs3st3b1 G A 11: 63,921,598 S97L probably benign Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Nacad A G 11: 6,602,255 L312P probably damaging Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slc26a5 T C 5: 21,820,350 D457G possibly damaging Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tmprss15 T A 16: 79,003,378 I621F probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7085:Tns1 UTSW 1 73925462 missense probably benign 0.00
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACTGCTGTGGACAGGAATCAC -3'
(R):5'- GACCGCCTACTAAGTGGCTTTG -3'

Sequencing Primer
(F):5'- TGGACAGGAATCACCCGGTTG -3'
(R):5'- GAAAAGCAAGGCGCCATGTACC -3'
Posted On2018-06-06