Incidental Mutation 'R6525:Fam208b'
ID521745
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6525 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 3576540 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 455 (Q455*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect probably null
Transcript: ENSMUST00000096069
AA Change: Q1137*
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: Q1137*

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect probably null
Transcript: ENSMUST00000222909
AA Change: Q455*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hs3st3b1 G A 11: 63,921,598 S97L probably benign Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Nacad A G 11: 6,602,255 L312P probably damaging Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slc26a5 T C 5: 21,820,350 D457G possibly damaging Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tmprss15 T A 16: 79,003,378 I621F probably damaging Het
Tns1 C T 1: 73,953,470 S683N probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTCCCTTAAGGTAACAGAGG -3'
(R):5'- TGGTTAAACGAGTATCCCCTGC -3'

Sequencing Primer
(F):5'- TCCCTTAAGGTAACAGAGGTTGATG -3'
(R):5'- GCCTCGAGTGTTCAGTATCCTATG -3'
Posted On2018-06-06