Incidental Mutation 'R6553:Cyp2c50'
ID521811
Institutional Source Beutler Lab
Gene Symbol Cyp2c50
Ensembl Gene ENSMUSG00000054827
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 50
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6553 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40089688-40113950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40090602 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 130 (T130A)
Ref Sequence ENSEMBL: ENSMUSP00000079065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068094] [ENSMUST00000080171]
Predicted Effect probably benign
Transcript: ENSMUST00000068094
AA Change: T130A

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068039
Gene: ENSMUSG00000054827
AA Change: T130A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 225 3.7e-54 PFAM
Pfam:p450 213 428 6.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080171
AA Change: T130A

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079065
Gene: ENSMUSG00000054827
AA Change: T130A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Chd1 A G 17: 15,725,430 N72S probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 H238R possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Vmn2r97 G A 17: 18,930,304 W471* probably null Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Cyp2c50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Cyp2c50 APN 19 40092284 missense probably benign 0.12
IGL01463:Cyp2c50 APN 19 40090978 missense probably damaging 1.00
IGL01669:Cyp2c50 APN 19 40098051 missense probably damaging 1.00
IGL02008:Cyp2c50 APN 19 40091099 nonsense probably null
IGL02331:Cyp2c50 APN 19 40090943 critical splice acceptor site probably null
IGL02830:Cyp2c50 APN 19 40098056 missense probably benign 0.00
R0115:Cyp2c50 UTSW 19 40092393 splice site probably benign
R1666:Cyp2c50 UTSW 19 40091055 missense probably benign
R1668:Cyp2c50 UTSW 19 40091055 missense probably benign
R1679:Cyp2c50 UTSW 19 40111415 missense possibly damaging 0.93
R2425:Cyp2c50 UTSW 19 40089848 missense probably benign 0.20
R2509:Cyp2c50 UTSW 19 40090569 missense probably benign
R2570:Cyp2c50 UTSW 19 40090320 missense probably benign 0.01
R3040:Cyp2c50 UTSW 19 40098126 missense probably benign 0.02
R3983:Cyp2c50 UTSW 19 40113518 missense possibly damaging 0.64
R4425:Cyp2c50 UTSW 19 40090692 missense possibly damaging 0.94
R4484:Cyp2c50 UTSW 19 40090639 missense probably damaging 1.00
R4520:Cyp2c50 UTSW 19 40090689 missense probably benign 0.02
R4820:Cyp2c50 UTSW 19 40113580 missense probably damaging 1.00
R4978:Cyp2c50 UTSW 19 40098057 missense probably damaging 1.00
R5335:Cyp2c50 UTSW 19 40090616 missense probably benign 0.00
R5807:Cyp2c50 UTSW 19 40113500 missense probably damaging 1.00
R5955:Cyp2c50 UTSW 19 40090943 critical splice acceptor site probably null
R6560:Cyp2c50 UTSW 19 40096855 missense probably benign 0.03
R7241:Cyp2c50 UTSW 19 40090568 missense probably benign
R7389:Cyp2c50 UTSW 19 40090663 missense probably benign 0.01
R7511:Cyp2c50 UTSW 19 40092190 splice site probably null
Z1088:Cyp2c50 UTSW 19 40097955 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGGAAAGCAGAGGCCAACTC -3'
(R):5'- AGGGCAATGCATGGATTGGC -3'

Sequencing Primer
(F):5'- AACTCTGCTCCTGAGACACAGTTTG -3'
(R):5'- GGATTGGCCATTCACTGAAAC -3'
Posted On2018-06-06