Mutagenetix > Incidental Mutation

Incidental Mutation 'R6554:Reln'

521834

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

044679-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R6554 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22089452-22549700 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22101838 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 3364 (Y3364C)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: Y3364C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: Y3364C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160791

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: Y3364C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: Y3364C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200667

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,618,246 (GRCm39)	R180C	probably damaging	Het
B3galt9	C	A	2: 34,729,276 (GRCm39)	S358R	probably benign	Het
Ces1b	C	A	8: 93,791,619 (GRCm39)	V327L	probably benign	Het
Cps1	C	T	1: 67,213,628 (GRCm39)	R787*	probably null	Het
Dmrt2	C	T	19: 25,655,312 (GRCm39)	P304S	probably damaging	Het
Dop1b	A	G	16: 93,557,346 (GRCm39)	D429G	probably benign	Het
Dync1h1	T	A	12: 110,616,282 (GRCm39)	M3111K	probably benign	Het
Dync2h1	A	G	9: 7,037,699 (GRCm39)	V3393A	probably benign	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Fam184a	T	C	10: 53,517,063 (GRCm39)	D1007G	possibly damaging	Het
Flt3	A	C	5: 147,312,545 (GRCm39)	L132W	probably damaging	Het
Gm14322	G	A	2: 177,410,220 (GRCm39)	S60N	possibly damaging	Het
Katnip	C	T	7: 125,449,914 (GRCm39)	R993C	probably damaging	Het
Kcnj16	T	A	11: 110,916,131 (GRCm39)	Y264*	probably null	Het
Klkb1	T	A	8: 45,726,591 (GRCm39)	I471F	probably damaging	Het
Lrfn4	T	C	19: 4,663,914 (GRCm39)	T207A	probably damaging	Het
Mfsd4b5	T	A	10: 39,862,428 (GRCm39)	T32S	probably benign	Het
Mtbp	A	G	15: 55,430,645 (GRCm39)	D234G	probably damaging	Het
Nfix	T	C	8: 85,454,279 (GRCm39)	T218A	possibly damaging	Het
Nsd3	A	T	8: 26,152,891 (GRCm39)	E410D	probably damaging	Het
Or4g17	C	T	2: 111,209,504 (GRCm39)	S53F	possibly damaging	Het
Or5aq7	A	T	2: 86,937,970 (GRCm39)	S254T	probably benign	Het
Selplg	G	A	5: 113,958,210 (GRCm39)	P32L	probably benign	Het
Serpina1d	A	T	12: 103,731,062 (GRCm39)	H305Q	probably benign	Het
Skic8	A	T	9: 54,634,929 (GRCm39)	I88N	probably damaging	Het
Skint8	G	A	4: 111,784,413 (GRCm39)	C13Y	probably benign	Het
Smc4	G	A	3: 68,936,848 (GRCm39)	V863I	probably benign	Het
Spdl1	T	G	11: 34,713,397 (GRCm39)	N224T	possibly damaging	Het
Sprr1b	T	G	3: 92,344,420 (GRCm39)	Q152P	possibly damaging	Het
St6gal1	A	G	16: 23,140,405 (GRCm39)	N192S	probably benign	Het
Tbc1d8	T	C	1: 39,445,903 (GRCm39)	N96S	probably damaging	Het
Tbccd1	A	T	16: 22,640,874 (GRCm39)	I501K	probably damaging	Het
Tmem161b	C	A	13: 84,370,537 (GRCm39)		probably benign	Het
Unk	T	C	11: 115,942,285 (GRCm39)	I293T	probably damaging	Het
Vmn2r61	A	G	7: 41,926,139 (GRCm39)	E548G	probably damaging	Het
Wdr97	A	G	15: 76,239,178 (GRCm39)	D85G	possibly damaging	Het
Zeb2	A	T	2: 44,887,524 (GRCm39)	V496E	probably damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,215,125 (GRCm39)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,250,007 (GRCm39)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,359,948 (GRCm39)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,265,378 (GRCm39)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,223,848 (GRCm39)	critical splice donor site	probably null
IGL00900:Reln	APN	5	22,185,115 (GRCm39)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	22,184,664 (GRCm39)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	22,191,965 (GRCm39)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	22,174,031 (GRCm39)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	22,124,067 (GRCm39)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,376,249 (GRCm39)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	22,174,077 (GRCm39)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	22,124,173 (GRCm39)	nonsense	probably null
IGL01361:Reln	APN	5	22,124,019 (GRCm39)	missense	probably benign	0.06
IGL01446:Reln	APN	5	22,174,315 (GRCm39)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,245,403 (GRCm39)	missense	probably benign	0.40
IGL01612:Reln	APN	5	22,101,928 (GRCm39)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	22,125,436 (GRCm39)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	22,152,512 (GRCm39)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,549,244 (GRCm39)	nonsense	probably null
IGL01875:Reln	APN	5	22,109,715 (GRCm39)	missense	probably benign
IGL02013:Reln	APN	5	22,155,877 (GRCm39)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	22,184,014 (GRCm39)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	22,114,956 (GRCm39)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	22,109,729 (GRCm39)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	22,115,990 (GRCm39)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,285,789 (GRCm39)	nonsense	probably null
IGL02408:Reln	APN	5	22,106,617 (GRCm39)	missense	probably benign	0.44
IGL02415:Reln	APN	5	22,176,949 (GRCm39)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,245,425 (GRCm39)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,239,750 (GRCm39)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,308,355 (GRCm39)	missense	probably benign	0.09
IGL02720:Reln	APN	5	22,202,939 (GRCm39)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	22,090,546 (GRCm39)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	22,200,363 (GRCm39)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	22,115,842 (GRCm39)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	22,115,834 (GRCm39)	missense	probably damaging	0.99
Fishing	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,311,058 (GRCm39)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	22,130,369 (GRCm39)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,209,134 (GRCm39)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,333,647 (GRCm39)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	22,153,447 (GRCm39)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0266:Reln	UTSW	5	22,193,774 (GRCm39)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,432,511 (GRCm39)	splice site	probably benign
R0333:Reln	UTSW	5	22,134,240 (GRCm39)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	22,155,820 (GRCm39)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,253,798 (GRCm39)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	22,125,494 (GRCm39)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	22,152,406 (GRCm39)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,256,274 (GRCm39)	splice site	probably benign
R0541:Reln	UTSW	5	22,185,107 (GRCm39)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,215,148 (GRCm39)	missense	probably benign	0.36
R0617:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,223,867 (GRCm39)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	22,118,228 (GRCm39)	missense	probably benign	0.44
R0704:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,432,626 (GRCm39)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,239,662 (GRCm39)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,239,773 (GRCm39)	missense	probably benign
R1163:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R1222:Reln	UTSW	5	22,191,953 (GRCm39)	missense	probably null	0.97
R1226:Reln	UTSW	5	22,115,864 (GRCm39)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,333,600 (GRCm39)	splice site	probably benign
R1532:Reln	UTSW	5	22,239,742 (GRCm39)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	22,165,376 (GRCm39)	missense	probably benign	0.01
R1565:Reln	UTSW	5	22,130,211 (GRCm39)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,265,366 (GRCm39)	missense	probably benign	0.01
R1636:Reln	UTSW	5	22,203,681 (GRCm39)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	22,134,084 (GRCm39)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	22,160,093 (GRCm39)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,215,287 (GRCm39)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	22,184,000 (GRCm39)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,249,960 (GRCm39)	critical splice donor site	probably null
R1991:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	22,147,625 (GRCm39)	missense	probably benign	0.01
R2072:Reln	UTSW	5	22,124,175 (GRCm39)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,223,998 (GRCm39)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	22,174,083 (GRCm39)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,253,003 (GRCm39)	missense	probably benign	0.30
R2219:Reln	UTSW	5	22,177,045 (GRCm39)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	22,192,076 (GRCm39)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	22,101,784 (GRCm39)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,359,954 (GRCm39)	missense	probably benign	0.00
R2321:Reln	UTSW	5	22,120,018 (GRCm39)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	22,184,688 (GRCm39)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,549,367 (GRCm39)	missense	unknown
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,245,418 (GRCm39)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	22,200,587 (GRCm39)	splice site	probably benign
R3713:Reln	UTSW	5	22,109,732 (GRCm39)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	22,153,564 (GRCm39)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	22,116,012 (GRCm39)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	22,115,847 (GRCm39)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	22,183,999 (GRCm39)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	22,200,364 (GRCm39)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,432,628 (GRCm39)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,333,630 (GRCm39)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,239,582 (GRCm39)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	22,106,741 (GRCm39)	missense	probably benign	0.44
R4615:Reln	UTSW	5	22,177,870 (GRCm39)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,357,461 (GRCm39)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	22,124,220 (GRCm39)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,254,698 (GRCm39)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,549,183 (GRCm39)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,223,844 (GRCm39)	splice site	probably null
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4896:Reln	UTSW	5	22,160,236 (GRCm39)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	22,184,718 (GRCm39)	missense	probably benign	0.02
R4912:Reln	UTSW	5	22,130,191 (GRCm39)	missense	probably benign	0.29
R4922:Reln	UTSW	5	22,200,585 (GRCm39)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	22,165,424 (GRCm39)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,239,636 (GRCm39)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	22,153,510 (GRCm39)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	22,101,075 (GRCm39)	missense	probably benign	0.00
R5119:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5125:Reln	UTSW	5	22,118,239 (GRCm39)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	22,153,627 (GRCm39)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	22,193,763 (GRCm39)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,308,395 (GRCm39)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,216,161 (GRCm39)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,244,527 (GRCm39)	missense	probably benign
R5400:Reln	UTSW	5	22,184,712 (GRCm39)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,209,201 (GRCm39)	missense	probably benign	0.00
R5514:Reln	UTSW	5	22,176,883 (GRCm39)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	22,137,713 (GRCm39)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,244,663 (GRCm39)	nonsense	probably null
R5648:Reln	UTSW	5	22,203,570 (GRCm39)	missense	probably benign	0.04
R5649:Reln	UTSW	5	22,106,623 (GRCm39)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,311,081 (GRCm39)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,223,054 (GRCm39)	missense	probably benign	0.01
R5815:Reln	UTSW	5	22,152,431 (GRCm39)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	22,104,111 (GRCm39)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	22,116,048 (GRCm39)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	22,153,594 (GRCm39)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,265,331 (GRCm39)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,491,942 (GRCm39)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,357,482 (GRCm39)	nonsense	probably null
R6351:Reln	UTSW	5	22,106,661 (GRCm39)	nonsense	probably null
R6369:Reln	UTSW	5	22,256,359 (GRCm39)	missense	probably benign	0.03
R6371:Reln	UTSW	5	22,200,511 (GRCm39)	missense	probably benign
R6374:Reln	UTSW	5	22,285,712 (GRCm39)	missense	probably benign	0.06
R6425:Reln	UTSW	5	22,116,018 (GRCm39)	nonsense	probably null
R6442:Reln	UTSW	5	22,137,774 (GRCm39)	missense	probably benign
R6445:Reln	UTSW	5	22,124,212 (GRCm39)	missense	probably benign	0.05
R6641:Reln	UTSW	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	22,183,905 (GRCm39)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,239,568 (GRCm39)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	22,104,177 (GRCm39)	missense	probably benign	0.18
R6932:Reln	UTSW	5	22,190,855 (GRCm39)	missense	probably benign	0.00
R6948:Reln	UTSW	5	22,177,033 (GRCm39)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	22,181,562 (GRCm39)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	22,120,085 (GRCm39)	nonsense	probably null
R7091:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably null	0.08
R7135:Reln	UTSW	5	22,181,594 (GRCm39)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,311,095 (GRCm39)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	22,147,618 (GRCm39)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,252,945 (GRCm39)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	22,183,921 (GRCm39)	missense	probably benign	0.03
R7393:Reln	UTSW	5	22,181,349 (GRCm39)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,256,365 (GRCm39)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	22,176,932 (GRCm39)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	22,176,951 (GRCm39)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,308,433 (GRCm39)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	22,147,739 (GRCm39)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	22,134,125 (GRCm39)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,432,636 (GRCm39)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	22,181,276 (GRCm39)	nonsense	probably null
R7588:Reln	UTSW	5	22,090,566 (GRCm39)	missense	probably benign	0.03
R7631:Reln	UTSW	5	22,176,933 (GRCm39)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	22,183,929 (GRCm39)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,244,633 (GRCm39)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,339,690 (GRCm39)	missense	probably benign	0.00
R7938:Reln	UTSW	5	22,155,870 (GRCm39)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	22,104,082 (GRCm39)	nonsense	probably null
R8062:Reln	UTSW	5	22,176,990 (GRCm39)	missense	probably benign	0.00
R8222:Reln	UTSW	5	22,136,475 (GRCm39)	nonsense	probably null
R8266:Reln	UTSW	5	22,223,085 (GRCm39)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,209,110 (GRCm39)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,209,229 (GRCm39)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	22,147,672 (GRCm39)	missense	probably benign	0.37
R8801:Reln	UTSW	5	22,155,854 (GRCm39)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	22,130,257 (GRCm39)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	22,090,512 (GRCm39)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	22,104,155 (GRCm39)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	22,184,577 (GRCm39)	missense	probably benign	0.00
R9022:Reln	UTSW	5	22,181,613 (GRCm39)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,253,036 (GRCm39)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,216,059 (GRCm39)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	22,130,198 (GRCm39)	missense	probably benign	0.01
R9126:Reln	UTSW	5	22,160,194 (GRCm39)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	22,155,815 (GRCm39)	critical splice donor site	probably null
R9182:Reln	UTSW	5	22,106,617 (GRCm39)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,357,471 (GRCm39)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,549,200 (GRCm39)	nonsense	probably null
R9241:Reln	UTSW	5	22,174,067 (GRCm39)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	22,120,151 (GRCm39)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	22,153,545 (GRCm39)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,209,209 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,193,705 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,285,689 (GRCm39)	missense	probably benign	0.01
R9309:Reln	UTSW	5	22,176,866 (GRCm39)	missense	probably benign	0.37
R9338:Reln	UTSW	5	22,202,937 (GRCm39)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,549,202 (GRCm39)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	22,120,105 (GRCm39)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,549,198 (GRCm39)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	22,125,508 (GRCm39)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	22,136,427 (GRCm39)	missense	probably benign	0.26
R9745:Reln	UTSW	5	22,152,525 (GRCm39)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	22,155,943 (GRCm39)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	22,184,022 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,209,080 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,174,239 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,432,634 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,359,957 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AATGTCGGCAGTCTGGGATG -3'
(R):5'- ACAGAGATTGTAAACTTCCTTCTCC -3'

Sequencing Primer
(F):5'- CTGCCTAGGTTCACGGCATTG -3'
(R):5'- ACAGACAGTTGCAACAGC -3'

Posted On

2018-06-06