Incidental Mutation 'R6557:Ica1l'
ID521883
Institutional Source Beutler Lab
Gene Symbol Ica1l
Ensembl Gene ENSMUSG00000026018
Gene Nameislet cell autoantigen 1-like
Synonyms1700030B17Rik, Als2cr15
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R6557 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location59982490-60043184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59997625 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 336 (T336A)
Ref Sequence ENSEMBL: ENSMUSP00000141103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027172] [ENSMUST00000189776] [ENSMUST00000191251]
Predicted Effect probably benign
Transcript: ENSMUST00000027172
AA Change: T336A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027172
Gene: ENSMUSG00000026018
AA Change: T336A

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189776
AA Change: T336A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141103
Gene: ENSMUSG00000026018
AA Change: T336A

DomainStartEndE-ValueType
Arfaptin 15 242 7.8e-117 SMART
ICA69 254 439 2.7e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191251
AA Change: T336A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140520
Gene: ENSMUSG00000026018
AA Change: T336A

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced male fertility with oligospermia, globospermia, and abnormal spermiogenesis, sperm nucleus and mitochondrial sheath morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Gpc5 A T 14: 115,092,534 probably benign Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Map10 T C 8: 125,670,252 V128A probably damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Olfr1275 T C 2: 111,231,631 H54R probably benign Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Tdrd5 T C 1: 156,300,721 K137R probably benign Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Ica1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Ica1l APN 1 60013947 missense probably damaging 1.00
IGL01526:Ica1l APN 1 60015757 missense probably damaging 0.99
IGL02538:Ica1l APN 1 60010186 missense probably benign 0.01
IGL02966:Ica1l APN 1 60010139 missense probably damaging 1.00
IGL03379:Ica1l APN 1 59997621 missense probably benign 0.07
PIT4466001:Ica1l UTSW 1 60015836 critical splice acceptor site probably null
R0278:Ica1l UTSW 1 60013996 missense probably benign 0.05
R0780:Ica1l UTSW 1 59997449 critical splice donor site probably null
R0926:Ica1l UTSW 1 60006297 missense probably benign 0.09
R1834:Ica1l UTSW 1 60028236 utr 5 prime probably benign
R2402:Ica1l UTSW 1 60006292 missense probably benign 0.00
R4155:Ica1l UTSW 1 60013893 missense possibly damaging 0.71
R4545:Ica1l UTSW 1 60013818 critical splice donor site probably null
R4754:Ica1l UTSW 1 60028162 missense probably damaging 1.00
R4791:Ica1l UTSW 1 60010201 missense probably damaging 1.00
R5096:Ica1l UTSW 1 60028154 missense possibly damaging 0.92
R5217:Ica1l UTSW 1 60015758 missense probably benign 0.03
R5461:Ica1l UTSW 1 60013851 missense probably damaging 1.00
R5780:Ica1l UTSW 1 60028215 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACACTTACTGTTGAAAGCTCCATC -3'
(R):5'- TGGCCATTTGACCTAAATCCTGTC -3'

Sequencing Primer
(F):5'- TCCATCAGCGTGAAGGCCAAG -3'
(R):5'- CTGTTCTCAACCAGCAGTT -3'
Posted On2018-06-06