Incidental Mutation 'R6557:Tdrd5'
ID521885
Institutional Source Beutler Lab
Gene Symbol Tdrd5
Ensembl Gene ENSMUSG00000060985
Gene Nametudor domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6557 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156255296-156303664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156300721 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 137 (K137R)
Ref Sequence ENSEMBL: ENSMUSP00000137156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121146] [ENSMUST00000141760] [ENSMUST00000167528]
Predicted Effect probably benign
Transcript: ENSMUST00000121146
AA Change: K232R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000137298
Gene: ENSMUSG00000060985
AA Change: K232R

DomainStartEndE-ValueType
Pfam:OST-HTH 6 76 3.7e-11 PFAM
Pfam:OST-HTH 126 194 1.5e-10 PFAM
Pfam:OST-HTH 290 361 7.4e-10 PFAM
TUDOR 532 590 3.25e-7 SMART
low complexity region 739 753 N/A INTRINSIC
low complexity region 1001 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141760
AA Change: K137R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137156
Gene: ENSMUSG00000060985
AA Change: K137R

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167528
AA Change: K155R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137182
Gene: ENSMUSG00000060985
AA Change: K155R

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 1.4e-9 PFAM
Pfam:OST-HTH 213 284 6.4e-9 PFAM
TUDOR 455 513 3.25e-7 SMART
low complexity region 662 676 N/A INTRINSIC
low complexity region 924 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with defective spermatid elongation, occasional arrested male meiosis, and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Gpc5 A T 14: 115,092,534 probably benign Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ica1l T C 1: 59,997,625 T336A probably benign Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Map10 T C 8: 125,670,252 V128A probably damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Olfr1275 T C 2: 111,231,631 H54R probably benign Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Tdrd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Tdrd5 APN 1 156301827 missense probably benign 0.32
IGL02441:Tdrd5 APN 1 156259943 splice site probably benign
IGL02932:Tdrd5 APN 1 156270620 missense possibly damaging 0.52
R0049:Tdrd5 UTSW 1 156301903 missense probably damaging 1.00
R0416:Tdrd5 UTSW 1 156285481 missense probably damaging 0.96
R0518:Tdrd5 UTSW 1 156262941 missense probably damaging 0.99
R1439:Tdrd5 UTSW 1 156277487 missense probably damaging 1.00
R1454:Tdrd5 UTSW 1 156259836 missense probably benign 0.41
R1497:Tdrd5 UTSW 1 156255802 missense probably benign 0.28
R1774:Tdrd5 UTSW 1 156277509 missense probably damaging 1.00
R2101:Tdrd5 UTSW 1 156301639 missense probably damaging 1.00
R2125:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2126:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2197:Tdrd5 UTSW 1 156259865 missense probably benign 0.02
R3820:Tdrd5 UTSW 1 156285483 missense probably benign 0.16
R3928:Tdrd5 UTSW 1 156300778 missense probably benign 0.06
R4258:Tdrd5 UTSW 1 156259742 missense probably benign 0.00
R4502:Tdrd5 UTSW 1 156300764 missense probably benign 0.00
R4601:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4602:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4610:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4611:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4674:Tdrd5 UTSW 1 156277435 missense probably damaging 1.00
R4722:Tdrd5 UTSW 1 156302375 missense probably benign 0.31
R4778:Tdrd5 UTSW 1 156255587 missense probably damaging 0.98
R5737:Tdrd5 UTSW 1 156300724 missense probably benign 0.01
R5881:Tdrd5 UTSW 1 156294500 missense probably damaging 0.98
R5900:Tdrd5 UTSW 1 156277435 nonsense probably null
R6234:Tdrd5 UTSW 1 156293377 missense possibly damaging 0.93
R7068:Tdrd5 UTSW 1 156284271 missense probably damaging 1.00
R7184:Tdrd5 UTSW 1 156259935 missense probably benign 0.30
R7199:Tdrd5 UTSW 1 156301723 missense probably damaging 0.98
R7432:Tdrd5 UTSW 1 156302432 missense probably damaging 1.00
R7469:Tdrd5 UTSW 1 156262905 missense probably benign 0.00
X0026:Tdrd5 UTSW 1 156285427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTCTATGCCCCAGTATAGG -3'
(R):5'- ATTTCCCCTTCTAAACTGAGGGC -3'

Sequencing Primer
(F):5'- TGCCAGGGCCAGAAAGC -3'
(R):5'- CTGAGGGCAGTTAGTATACAGTAGCC -3'
Posted On2018-06-06