Incidental Mutation 'R6557:Vmn2r111'
ID521927
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6557 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22559051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cxcl15 C T 5: 90,794,566 probably benign Het
Dysf A G 6: 84,186,384 D1580G probably damaging Het
Gpc5 A T 14: 115,092,534 probably benign Het
Greb1 T C 12: 16,710,383 I575V probably benign Het
Hecw1 T C 13: 14,316,646 E174G possibly damaging Het
Hip1 T C 5: 135,428,719 D300G possibly damaging Het
Ica1l T C 1: 59,997,625 T336A probably benign Het
Ikzf3 C T 11: 98,516,881 A45T probably benign Het
Krtap16-1 T C 11: 99,985,130 S483G possibly damaging Het
Lamb2 T C 9: 108,488,400 L1394P probably damaging Het
Liph T A 16: 21,983,920 E133V possibly damaging Het
Mamdc2 A G 19: 23,310,845 S610P possibly damaging Het
Map10 T C 8: 125,670,252 V128A probably damaging Het
Mon2 C A 10: 123,016,402 C1022F probably damaging Het
Nfatc3 T C 8: 106,119,354 S1039P probably benign Het
Nov A T 15: 54,747,927 R153* probably null Het
Olfr1275 T C 2: 111,231,631 H54R probably benign Het
Scaper T C 9: 55,550,850 N879S probably benign Het
Sec24d T C 3: 123,343,087 Y490H probably damaging Het
Tdrd5 T C 1: 156,300,721 K137R probably benign Het
Topaz1 A G 9: 122,748,895 N290S probably benign Het
Zfp638 C A 6: 83,930,110 P419Q probably damaging Het
Zzz3 T A 3: 152,428,460 L385Q probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAAAAGATGCAGCCCAATTTCTAC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On2018-06-06