Incidental Mutation 'R6527:Mast2'
ID521946
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6527 (G1)
Quality Score210.009
Status Not validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116314939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 604 (D604G)
Ref Sequence ENSEMBL: ENSMUSP00000102095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]
Predicted Effect probably damaging
Transcript: ENSMUST00000003908
AA Change: D536G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: D536G

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106484
AA Change: D543G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: D543G

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106485
AA Change: D597G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: D597G

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106486
AA Change: D604G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: D604G

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156884
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R1981:Mast2 UTSW 4 116314840 missense probably damaging 1.00
R2081:Mast2 UTSW 4 116330474 splice site probably null
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4153:Mast2 UTSW 4 116315963 missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4671:Mast2 UTSW 4 116308650 missense probably damaging 1.00
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5322:Mast2 UTSW 4 116333411 critical splice donor site probably null
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCTCAATTATCAAGAGGATGCCC -3'
(R):5'- TGATAGTCTTGAAAGCCACTTGC -3'

Sequencing Primer
(F):5'- TTATCAAGAGGATGCCCTGAAC -3'
(R):5'- AGCCACTTGCAAATTGATTTCCTG -3'
Posted On2018-06-06