Incidental Mutation 'R6527:Olfr1341'
ID521948
Institutional Source Beutler Lab
Gene Symbol Olfr1341
Ensembl Gene ENSMUSG00000046790
Gene Nameolfactory receptor 1341
SynonymsMOR258-1, GA_x6K02T2QD9B-18838170-18837232
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118703523-118713438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118709848 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 147 (F147Y)
Ref Sequence ENSEMBL: ENSMUSP00000149466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061215] [ENSMUST00000214131] [ENSMUST00000215117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061215
AA Change: F147Y

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095523
Gene: ENSMUSG00000046790
AA Change: F147Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214131
AA Change: F147Y

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215117
AA Change: F147Y

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Olfr1341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Olfr1341 APN 4 118709922 missense probably damaging 1.00
IGL02699:Olfr1341 APN 4 118710198 missense probably benign 0.36
IGL02798:Olfr1341 APN 4 118709499 missense probably damaging 0.97
IGL03271:Olfr1341 APN 4 118709785 missense probably damaging 0.99
R0085:Olfr1341 UTSW 4 118709881 missense probably benign 0.18
R0355:Olfr1341 UTSW 4 118709611 missense probably benign 0.06
R1134:Olfr1341 UTSW 4 118710279 missense probably damaging 0.97
R1561:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R1574:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R2167:Olfr1341 UTSW 4 118710055 missense probably benign 0.18
R2182:Olfr1341 UTSW 4 118710345 makesense probably null
R2237:Olfr1341 UTSW 4 118709995 missense probably damaging 1.00
R3775:Olfr1341 UTSW 4 118710154 missense probably damaging 1.00
R6000:Olfr1341 UTSW 4 118710244 missense probably damaging 1.00
R6249:Olfr1341 UTSW 4 118709713 missense probably damaging 1.00
R6331:Olfr1341 UTSW 4 118709947 missense probably benign 0.34
X0063:Olfr1341 UTSW 4 118709755 missense probably damaging 1.00
Z1088:Olfr1341 UTSW 4 118710226 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTGTGCCCCAGATGTTG -3'
(R):5'- GGATCAGTATGACACTAAACCCAAG -3'

Sequencing Primer
(F):5'- ATGTTGGCACATCTGGCCAG -3'
(R):5'- GTATGAAGTCCACATGGTCATTGAC -3'
Posted On2018-06-06