Incidental Mutation 'R6527:Cfap74'
ID521952
Institutional Source Beutler Lab
Gene Symbol Cfap74
Ensembl Gene ENSMUSG00000078490
Gene Namecilia and flagella associated protein 74
Synonyms2010015L04Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: isoform 1: NM_177674.5; isoform 2: NM_001166029.1; MGI: 1917130

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155409190-155466823 bp(+) (GRCm38)
Type of Mutationunclassified (273 bp from exon)
DNA Base Change (assembly) A to G at 155422265 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123952] [ENSMUST00000151083]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094408
SMART Domains Protein: ENSMUSP00000091975
Gene: ENSMUSG00000042233

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123952
SMART Domains Protein: ENSMUSP00000131899
Gene: ENSMUSG00000078490

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145520
Predicted Effect possibly damaging
Transcript: ENSMUST00000151083
AA Change: D151G

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123626
Gene: ENSMUSG00000078490
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Cfap74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Cfap74 APN 4 155418986 missense possibly damaging 0.95
paranoid UTSW 4 155454024 utr 5 prime probably benign
sensibile UTSW 4 155441286 missense probably null 0.03
touchy UTSW 4 155463072 missense probably benign 0.27
FR4304:Cfap74 UTSW 4 155415760 missense possibly damaging 0.93
P0007:Cfap74 UTSW 4 155422228 missense possibly damaging 0.83
PIT4434001:Cfap74 UTSW 4 155463964 missense unknown
R0025:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0034:Cfap74 UTSW 4 155460887 splice site probably benign
R0193:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0306:Cfap74 UTSW 4 155465439 unclassified probably benign
R0427:Cfap74 UTSW 4 155441277 missense probably benign 0.02
R0905:Cfap74 UTSW 4 155418696 critical splice donor site probably null
R1116:Cfap74 UTSW 4 155433996 missense probably benign 0.15
R1548:Cfap74 UTSW 4 155434045 missense probably benign 0.45
R1950:Cfap74 UTSW 4 155427430 critical splice donor site probably null
R2009:Cfap74 UTSW 4 155420267 missense possibly damaging 0.77
R2029:Cfap74 UTSW 4 155442081 missense possibly damaging 0.74
R2135:Cfap74 UTSW 4 155429940 missense probably damaging 0.97
R2135:Cfap74 UTSW 4 155429951 missense probably damaging 1.00
R2154:Cfap74 UTSW 4 155429296 missense possibly damaging 0.94
R2413:Cfap74 UTSW 4 155418624 missense possibly damaging 0.76
R2418:Cfap74 UTSW 4 155455709 utr 5 prime probably benign
R2930:Cfap74 UTSW 4 155438170 missense probably damaging 0.97
R3965:Cfap74 UTSW 4 155446717 missense probably damaging 1.00
R4078:Cfap74 UTSW 4 155455671 missense probably damaging 0.98
R4238:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4239:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4240:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4491:Cfap74 UTSW 4 155429171 missense probably benign 0.22
R4731:Cfap74 UTSW 4 155463602 intron probably benign
R5333:Cfap74 UTSW 4 155436740 missense probably damaging 0.99
R5362:Cfap74 UTSW 4 155438166 missense probably damaging 0.98
R5425:Cfap74 UTSW 4 155455692 utr 5 prime probably benign
R5468:Cfap74 UTSW 4 155426041 missense probably benign 0.27
R5839:Cfap74 UTSW 4 155422750 critical splice donor site probably null
R6010:Cfap74 UTSW 4 155454038 missense possibly damaging 0.83
R6284:Cfap74 UTSW 4 155451796 missense probably damaging 0.96
R6323:Cfap74 UTSW 4 155463938 missense possibly damaging 0.54
R6389:Cfap74 UTSW 4 155423336 missense possibly damaging 0.69
R6513:Cfap74 UTSW 4 155441286 missense probably null 0.03
R6785:Cfap74 UTSW 4 155454024 utr 5 prime probably benign
R6980:Cfap74 UTSW 4 155466352 unclassified probably benign
R7039:Cfap74 UTSW 4 155454108 critical splice donor site probably null
R7077:Cfap74 UTSW 4 155455677 missense unknown
R7116:Cfap74 UTSW 4 155455061 missense unknown
R7227:Cfap74 UTSW 4 155460948 nonsense probably null
R7228:Cfap74 UTSW 4 155465050 missense unknown
R7261:Cfap74 UTSW 4 155465374 missense unknown
R7315:Cfap74 UTSW 4 155463019 missense unknown
T0970:Cfap74 UTSW 4 155463117 splice site probably null
X0066:Cfap74 UTSW 4 155463964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTCACCTCTGATCATCTG -3'
(R):5'- CAGCTGCTTTAACATGTCACC -3'

Sequencing Primer
(F):5'- CTGATCATCTGCTTTTGATGGAC -3'
(R):5'- TCCTAAGCATCTAGAAAGTGAAAAGC -3'
Posted On2018-06-06