Mutagenetix > Incidental Mutation

Incidental Mutation 'R6559:Mst1r'

521953

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv2, Ron, STK, friend virus susceptibility 2, CDw136, Fv-2, PTK8

MMRRC Submission

044683-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.340) question?

Stock #

R6559 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107784072-107797582 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107785470 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 376 (N376S)

Ref Sequence

ENSEMBL: ENSMUSP00000142201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: N376S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: N376S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158380

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195617
AA Change: N376S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: N376S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	C	T	4: 109,363,002 (GRCm39)	V106I	possibly damaging	Het
Actn4	T	C	7: 28,606,461 (GRCm39)	K284R	possibly damaging	Het
Adam20	G	C	8: 41,249,329 (GRCm39)	E480Q	probably benign	Het
Cdkl3	A	G	11: 51,916,696 (GRCm39)	T275A	probably benign	Het
Dync2h1	A	G	9: 7,139,501 (GRCm39)	I1378T	possibly damaging	Het
Fam186a	A	G	15: 99,842,356 (GRCm39)	I1296T	possibly damaging	Het
Fbf1	G	A	11: 116,046,272 (GRCm39)	T193M	probably benign	Het
Fcrl1	A	G	3: 87,298,560 (GRCm39)	I352V	probably benign	Het
Ifit3	T	C	19: 34,564,514 (GRCm39)	F20S	probably damaging	Het
Klhl3	G	A	13: 58,164,290 (GRCm39)	R431W	probably damaging	Het
Lipi	A	G	16: 75,337,982 (GRCm39)	V464A	probably benign	Het
Lrp6	T	C	6: 134,490,217 (GRCm39)	I120M	probably damaging	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Ncoa2	G	A	1: 13,220,841 (GRCm39)		probably null	Het
Odad2	T	C	18: 7,223,664 (GRCm39)	T460A	probably damaging	Het
Or6c215	A	T	10: 129,637,533 (GRCm39)	I287N	probably damaging	Het
Or8c10	A	G	9: 38,279,052 (GRCm39)	Y60C	probably damaging	Het
Teddm1a	A	T	1: 153,768,111 (GRCm39)	I192F	probably benign	Het
Tnfaip3	A	G	10: 18,882,996 (GRCm39)	S190P	probably damaging	Het
Ttc3	T	C	16: 94,223,208 (GRCm39)		probably null	Het
Zfp112	C	T	7: 23,825,888 (GRCm39)	Q619*	probably null	Het
Zscan4-ps3	A	G	7: 11,344,339 (GRCm39)	E99G	probably damaging	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107,790,449 (GRCm39)	splice site	probably benign
IGL01327:Mst1r	APN	9	107,785,043 (GRCm39)	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107,788,791 (GRCm39)	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107,794,005 (GRCm39)	splice site	probably null
IGL01983:Mst1r	APN	9	107,794,475 (GRCm39)	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107,794,478 (GRCm39)	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107,785,068 (GRCm39)	missense	probably damaging	1.00
IGL02203:Mst1r	APN	9	107,790,348 (GRCm39)	missense	possibly damaging	0.61
IGL02332:Mst1r	APN	9	107,785,025 (GRCm39)	nonsense	probably null
IGL02402:Mst1r	APN	9	107,794,026 (GRCm39)	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107,790,266 (GRCm39)	splice site	probably benign
IGL02942:Mst1r	APN	9	107,790,352 (GRCm39)	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107,785,403 (GRCm39)	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107,790,379 (GRCm39)	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107,791,748 (GRCm39)	nonsense	probably null
IGL03304:Mst1r	APN	9	107,785,137 (GRCm39)	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107,794,003 (GRCm39)	splice site	probably null
R0833:Mst1r	UTSW	9	107,791,975 (GRCm39)	missense	probably benign	0.00
R0833:Mst1r	UTSW	9	107,790,366 (GRCm39)	missense	probably benign
R1139:Mst1r	UTSW	9	107,797,168 (GRCm39)	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107,794,424 (GRCm39)	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107,785,523 (GRCm39)	missense	probably benign
R1479:Mst1r	UTSW	9	107,790,544 (GRCm39)	splice site	probably benign
R1541:Mst1r	UTSW	9	107,794,562 (GRCm39)	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107,797,179 (GRCm39)	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107,790,661 (GRCm39)	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107,790,411 (GRCm39)	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107,793,132 (GRCm39)	critical splice donor site	probably null
R1974:Mst1r	UTSW	9	107,791,962 (GRCm39)	missense	probably damaging	1.00
R2144:Mst1r	UTSW	9	107,790,367 (GRCm39)	missense	probably benign
R2221:Mst1r	UTSW	9	107,785,547 (GRCm39)	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107,795,069 (GRCm39)	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107,791,945 (GRCm39)	missense	probably benign
R4768:Mst1r	UTSW	9	107,788,849 (GRCm39)	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107,797,124 (GRCm39)	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107,789,440 (GRCm39)	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107,788,750 (GRCm39)	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107,784,773 (GRCm39)	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107,785,350 (GRCm39)	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107,784,547 (GRCm39)	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107,794,465 (GRCm39)	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107,793,052 (GRCm39)	missense	probably benign
R6522:Mst1r	UTSW	9	107,790,438 (GRCm39)	missense	probably benign	0.00
R6863:Mst1r	UTSW	9	107,797,225 (GRCm39)	missense	probably benign
R6868:Mst1r	UTSW	9	107,793,132 (GRCm39)	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107,788,843 (GRCm39)	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107,789,793 (GRCm39)	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107,785,392 (GRCm39)	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107,791,989 (GRCm39)	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107,791,989 (GRCm39)	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107,792,321 (GRCm39)	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107,797,211 (GRCm39)	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107,788,762 (GRCm39)	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107,784,319 (GRCm39)	start gained	probably benign
R7916:Mst1r	UTSW	9	107,784,777 (GRCm39)	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107,789,997 (GRCm39)	splice site	probably null
R8177:Mst1r	UTSW	9	107,784,784 (GRCm39)	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107,794,463 (GRCm39)	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107,791,718 (GRCm39)	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107,792,050 (GRCm39)	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107,792,478 (GRCm39)	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107,791,960 (GRCm39)	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107,790,402 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGACTGTCATTTTGCACCTAAAC -3'
(R):5'- TAGCCCGTATTCAGCTCCAC -3'

Sequencing Primer
(F):5'- ATTTTGCACCTAAACGCCGG -3'
(R):5'- GTATTCAGCTCCACAGGGTAC -3'

Posted On

2018-06-06