Incidental Mutation 'R6559:Cdkl3'
ID521959
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R6559 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52025869 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 275 (T275A)
Ref Sequence ENSEMBL: ENSMUSP00000123279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000128853] [ENSMUST00000143228]
Predicted Effect probably benign
Transcript: ENSMUST00000063303
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000063321
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109076
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109077
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109078
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109079
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109080
AA Change: T275A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109081
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120374
AA Change: T275A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121591
AA Change: T275A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128853
SMART Domains Protein: ENSMUSP00000121945
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 1 110 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143228
AA Change: T275A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389
AA Change: T275A

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147874
SMART Domains Protein: ENSMUSP00000119505
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Blast:S_TKc 2 36 5e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik C T 4: 109,505,805 V106I possibly damaging Het
Actn4 T C 7: 28,907,036 K284R possibly damaging Het
Adam20 G C 8: 40,796,292 E480Q probably benign Het
Armc4 T C 18: 7,223,664 T460A probably damaging Het
Dync2h1 A G 9: 7,139,501 I1378T possibly damaging Het
Fam186a A G 15: 99,944,475 I1296T possibly damaging Het
Fbf1 G A 11: 116,155,446 T193M probably benign Het
Fcrl1 A G 3: 87,391,253 I352V probably benign Het
Ifit3 T C 19: 34,587,114 F20S probably damaging Het
Klhl3 G A 13: 58,016,476 R431W probably damaging Het
Lipi A G 16: 75,541,094 V464A probably benign Het
Lrp6 T C 6: 134,513,254 I120M probably damaging Het
Mst1r A G 9: 107,908,271 N376S possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ncoa2 G A 1: 13,150,617 probably null Het
Olfr250 A G 9: 38,367,756 Y60C probably damaging Het
Olfr811 A T 10: 129,801,664 I287N probably damaging Het
Teddm1a A T 1: 153,892,365 I192F probably benign Het
Tnfaip3 A G 10: 19,007,248 S190P probably damaging Het
Ttc3 T C 16: 94,422,349 probably null Het
Zfp112 C T 7: 24,126,463 Q619* probably null Het
Zscan4-ps3 A G 7: 11,610,412 E99G probably damaging Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R0848:Cdkl3 UTSW 11 52011267 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 52032510 missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2077:Cdkl3 UTSW 11 52026839 missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7068:Cdkl3 UTSW 11 52011327 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCAGAATTTCCTGTTAGAAACCTG -3'
(R):5'- TGACAAAAGCTAGCTGCCTACC -3'

Sequencing Primer
(F):5'- GAAACCTGCTTGTTTACAGACTCTG -3'
(R):5'- TACCATGTACCTGGGCAGTAC -3'
Posted On2018-06-06