Incidental Mutation 'R6527:Lmod3'
ID521968
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Nameleiomodin 3 (fetal)
Synonyms5430424A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location97238534-97252759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97247378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 494 (D494G)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
Predicted Effect probably benign
Transcript: ENSMUST00000095655
AA Change: D494G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: D494G

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97252297 missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97247861 missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97252552 missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97247672 missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97238835 utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97247195 missense possibly damaging 0.92
Runted UTSW 6 97247273 missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97247345 missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97248071 missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97247877 missense probably benign 0.06
R4038:Lmod3 UTSW 6 97248314 missense probably benign 0.06
R4913:Lmod3 UTSW 6 97247164 splice site probably null
R5867:Lmod3 UTSW 6 97248002 missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97247614 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97252553 missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97247301 missense probably damaging 1.00
R7225:Lmod3 UTSW 6 97247384 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CGGATGTCATTCAAGAGCTGG -3'
(R):5'- GCAGCAGCAACTTAAAGAGC -3'

Sequencing Primer
(F):5'- GTCTCTGGGAGTGATTTCCACCAG -3'
(R):5'- GCTGATAGCTATGTTGGAGAATG -3'
Posted On2018-06-06