Incidental Mutation 'R6527:Tomt'
ID521973
Institutional Source Beutler Lab
Gene Symbol Tomt
Ensembl Gene ENSMUSG00000078630
Gene Nametransmembrane O-methyltransferase
SynonymsComt2, F930017I19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081679; MGI: 3707696

Is this an essential gene? Not available question?
Stock #R6527 (G1)
Quality Score213.009
Status Not validated
Chromosome7
Chromosomal Location101898370-101906359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101900392 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 230 (Y230H)
Ref Sequence ENSEMBL: ENSMUSP00000102583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000106973] [ENSMUST00000106978] [ENSMUST00000143835] [ENSMUST00000144207] [ENSMUST00000178851] [ENSMUST00000209334] [ENSMUST00000210984]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably benign
Transcript: ENSMUST00000035395
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098237
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106969
AA Change: Y230H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630
AA Change: Y230H

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106970
AA Change: Y230H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630
AA Change: Y230H

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106973
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106978
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect probably benign
Transcript: ENSMUST00000143835
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144207
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably benign
Transcript: ENSMUST00000178851
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000210984
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes two transcript forms. The short form has one open reading frame (ORF), which encodes the leucine-rich repeats (LRR)-containing protein of unknown function. This protein is called LRTOMT1 or LRRC51. The long form has two alternative ORFs; the upstream ORF has the same translation start codon as used in the short form and the resulting transcript is a candidate for nonsense-mediated decay, and the downstream ORF encodes a different protein, which is a transmembrane catechol-O-methyltransferase and is called LRTOMT2, TOMT or COMT2. The COMT2 is essential for auditory and vestibular function. Defects in the COMT2 can cause nonsyndromic deafness. Alternatively spliced transcript variants from each transcript form have been found for this gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a mutation of this gene exhibit marked hyperactivity, bidirectional circling and head-tossing. These behaviors are suppressed during sleep and nursing. Homozygous mutant males exhibit heightened male:male aggression. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Tomt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Tomt APN 7 101902186 missense probably benign 0.00
add UTSW 7 101902129 missense probably damaging 1.00
R1913:Tomt UTSW 7 101901247 missense probably damaging 1.00
R5737:Tomt UTSW 7 101900317 missense probably benign
X0018:Tomt UTSW 7 101900571 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACCATAGCATGTGTTGGATAC -3'
(R):5'- GCAGCTCAGAGGAAGTGATC -3'

Sequencing Primer
(F):5'- TACAAGACAGAGAGGGAAACG -3'
(R):5'- GTGATCCCACGCCTAAGAG -3'
Posted On2018-06-06