Incidental Mutation 'R6527:Abca16'
ID521975
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120477772 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 686 (I686N)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056042
AA Change: I686N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: I686N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120490
AA Change: I687N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: I687N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153845
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGCTGGTTTAAATGATGTTTGG -3'
(R):5'- AAATGGGTCAGCAACTTTGTG -3'

Sequencing Primer
(F):5'- CTGGTTTAAATGATGTTTGGGATTG -3'
(R):5'- GGGTCAGCAACTTTGTGTAAAATTGC -3'
Posted On2018-06-06