Incidental Mutation 'R6527:Jam3'
ID 521987
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Name junction adhesion molecule 3
Synonyms 1110002N23Rik, Jcam3, JAM-3, JAM-C
MMRRC Submission 044653-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # R6527 (G1)
Quality Score 118.009
Status Not validated
Chromosome 9
Chromosomal Location 27008680-27066717 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27066640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 8 (R8Q)
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472]
AlphaFold Q9D8B7
Predicted Effect unknown
Transcript: ENSMUST00000034472
AA Change: R8Q
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: R8Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213682
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,288 (GRCm39) T826A probably damaging Het
Abca16 T A 7: 120,076,995 (GRCm39) I686N possibly damaging Het
Abcb6 T C 1: 75,154,132 (GRCm39) probably null Het
Adgrl3 A C 5: 81,935,364 (GRCm39) E1299A probably damaging Het
Amd2 A C 10: 35,586,802 (GRCm39) Y252D probably damaging Het
Cfap74 A G 4: 155,506,722 (GRCm39) probably null Het
Dhx29 G T 13: 113,069,076 (GRCm39) K135N probably damaging Het
Dlg5 T A 14: 24,240,516 (GRCm39) D245V possibly damaging Het
Dscaml1 C T 9: 45,623,482 (GRCm39) Q83* probably null Het
Dsp T A 13: 38,379,849 (GRCm39) L1599Q probably damaging Het
Duox2 A G 2: 122,125,095 (GRCm39) V369A probably benign Het
Flacc1 T C 1: 58,731,572 (GRCm39) M1V probably null Het
Gbe1 T A 16: 70,230,560 (GRCm39) probably null Het
Gm7298 A G 6: 121,746,669 (GRCm39) K600R probably benign Het
Heatr4 C T 12: 84,026,537 (GRCm39) G240E probably damaging Het
Jakmip2 A G 18: 43,689,589 (GRCm39) V651A possibly damaging Het
Letm2 A G 8: 26,082,522 (GRCm39) probably benign Het
Lmod3 T C 6: 97,224,339 (GRCm39) D494G probably benign Het
Mast2 T C 4: 116,172,136 (GRCm39) D604G probably damaging Het
Mif4gd C T 11: 115,500,101 (GRCm39) probably null Het
Msr1 T C 8: 40,077,274 (GRCm39) E112G possibly damaging Het
Mtus2 A G 5: 148,214,408 (GRCm39) probably null Het
Muc4 A G 16: 32,753,433 (GRCm38) H1103R probably benign Het
Nudt14 T A 12: 112,898,507 (GRCm39) I198F possibly damaging Het
Or11j4 T A 14: 50,630,885 (GRCm39) L224* probably null Het
Or13p3 T A 4: 118,567,045 (GRCm39) F147Y possibly damaging Het
Or1n1b T C 2: 36,780,594 (GRCm39) T89A probably benign Het
Osbpl8 T C 10: 111,129,066 (GRCm39) I884T probably benign Het
Podxl2 T C 6: 88,819,912 (GRCm39) N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 (GRCm39) Y151C probably damaging Het
Prss42 T C 9: 110,629,924 (GRCm39) V226A possibly damaging Het
Psmd12 A G 11: 107,379,794 (GRCm39) I116V probably damaging Het
Psme4 A C 11: 30,782,175 (GRCm39) I872L probably benign Het
Rab11fip1 A T 8: 27,664,420 (GRCm39) V65E probably damaging Het
Ros1 T C 10: 52,019,473 (GRCm39) N700S possibly damaging Het
Slc15a4 G A 5: 127,673,773 (GRCm39) T547M probably damaging Het
Slfn3 T A 11: 83,103,932 (GRCm39) C268S probably benign Het
Smc5 T C 19: 23,205,554 (GRCm39) Q794R probably benign Het
Sqor A G 2: 122,651,206 (GRCm39) Y434C probably damaging Het
Steap4 T A 5: 8,028,502 (GRCm39) L360H probably damaging Het
Sycp1 A G 3: 102,806,203 (GRCm39) V496A probably benign Het
Tmem161b T G 13: 84,420,383 (GRCm39) M128R probably benign Het
Tmem59l T C 8: 70,938,775 (GRCm39) E102G probably damaging Het
Tnks A T 8: 35,340,247 (GRCm39) V457D probably benign Het
Tomt A G 7: 101,549,599 (GRCm39) Y230H probably damaging Het
Trim37 A G 11: 87,080,910 (GRCm39) N561D probably damaging Het
V1ra8 T A 6: 90,180,295 (GRCm39) I166K probably damaging Het
Vmn1r56 A G 7: 5,199,575 (GRCm39) V14A probably benign Het
Vsig8 T C 1: 172,387,925 (GRCm39) V5A possibly damaging Het
Vwa8 A T 14: 79,184,653 (GRCm39) S384C possibly damaging Het
Wwc1 C T 11: 35,744,264 (GRCm39) E853K probably benign Het
Zfp984 T C 4: 147,840,381 (GRCm39) N157D probably benign Het
Zzef1 G A 11: 72,765,816 (GRCm39) D1448N probably benign Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27,013,188 (GRCm39) missense probably damaging 1.00
IGL01311:Jam3 APN 9 27,010,019 (GRCm39) missense probably damaging 0.99
IGL01729:Jam3 APN 9 27,016,821 (GRCm39) missense probably damaging 1.00
IGL03233:Jam3 APN 9 27,013,217 (GRCm39) missense probably damaging 1.00
IGL03275:Jam3 APN 9 27,012,545 (GRCm39) missense probably damaging 0.99
R0267:Jam3 UTSW 9 27,017,701 (GRCm39) missense probably benign 0.01
R0547:Jam3 UTSW 9 27,010,184 (GRCm39) missense probably damaging 1.00
R0899:Jam3 UTSW 9 27,010,253 (GRCm39) missense probably damaging 1.00
R1499:Jam3 UTSW 9 27,017,701 (GRCm39) missense possibly damaging 0.93
R3926:Jam3 UTSW 9 27,017,701 (GRCm39) missense possibly damaging 0.93
R4044:Jam3 UTSW 9 27,013,159 (GRCm39) critical splice donor site probably null
R4977:Jam3 UTSW 9 27,009,669 (GRCm39) missense probably damaging 0.96
R6759:Jam3 UTSW 9 27,013,276 (GRCm39) missense probably benign 0.09
R7843:Jam3 UTSW 9 27,017,712 (GRCm39) critical splice acceptor site probably null
R8088:Jam3 UTSW 9 27,010,156 (GRCm39) missense probably benign 0.00
R9688:Jam3 UTSW 9 27,010,204 (GRCm39) missense probably benign 0.30
R9700:Jam3 UTSW 9 27,010,183 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCCACGGTCCTTCTAGAG -3'
(R):5'- CAGACTTGAGCTTTCTCGGTC -3'

Sequencing Primer
(F):5'- TCCTTCTAGAGGGCCGTGTC -3'
(R):5'- AGCTTTCTCGGTCACTATGG -3'
Posted On 2018-06-06