Incidental Mutation 'R6527:Psmd12'
ID522009
Institutional Source Beutler Lab
Gene Symbol Psmd12
Ensembl Gene ENSMUSG00000020720
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms1500002F15Rik, P55
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107479484-107504362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107488968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 116 (I116V)
Ref Sequence ENSEMBL: ENSMUSP00000102361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021063
AA Change: I136V

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: I136V

DomainStartEndE-ValueType
PINT 349 435 3.24e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106750
AA Change: I116V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: I116V

DomainStartEndE-ValueType
PINT 329 415 3.24e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106752
AA Change: I136V

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720
AA Change: I136V

DomainStartEndE-ValueType
Pfam:PCI 300 398 1.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Psmd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Psmd12 APN 11 107485781 missense probably benign 0.00
R0384:Psmd12 UTSW 11 107485721 missense probably benign 0.00
R1457:Psmd12 UTSW 11 107479646 missense probably damaging 1.00
R1661:Psmd12 UTSW 11 107491906 missense probably damaging 1.00
R2443:Psmd12 UTSW 11 107495737 missense probably damaging 1.00
R3806:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3807:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3840:Psmd12 UTSW 11 107485572 missense probably benign 0.02
R4212:Psmd12 UTSW 11 107485759 missense probably damaging 1.00
R4718:Psmd12 UTSW 11 107486433 missense probably benign 0.15
R5182:Psmd12 UTSW 11 107479659 missense probably damaging 1.00
R5586:Psmd12 UTSW 11 107486475 missense probably benign 0.35
R6171:Psmd12 UTSW 11 107491907 missense probably damaging 0.96
R6444:Psmd12 UTSW 11 107486454 missense possibly damaging 0.55
R7276:Psmd12 UTSW 11 107503645 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCTGTTACTTGGGGTCT -3'
(R):5'- TGTGCTGTGTACATGCTCACT -3'

Sequencing Primer
(F):5'- TGGGATCCAAATTGCAGTCC -3'
(R):5'- GTACATGCTCACTCTTGTTAACGTAG -3'
Posted On2018-06-06