Incidental Mutation 'R6527:Nudt14'
ID522015
Institutional Source Beutler Lab
Gene Symbol Nudt14
Ensembl Gene ENSMUSG00000002804
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112934291-112942124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112934887 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 198 (I198F)
Ref Sequence ENSEMBL: ENSMUSP00000152599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002881] [ENSMUST00000221397] [ENSMUST00000221497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002881
AA Change: I186F

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002881
Gene: ENSMUSG00000002804
AA Change: I186F

DomainStartEndE-ValueType
Pfam:NUDIX 39 211 3.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221397
AA Change: I198F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000221497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222932
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This enzyme contains a Nudix hydrolase domain and is a UDPG pyrophosphatase that hydrolyzes UDPG to produce glucose 1-phosphate and UMP. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Nudt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0279:Nudt14 UTSW 12 112938417 missense probably damaging 1.00
R1541:Nudt14 UTSW 12 112934928 missense probably damaging 1.00
R3026:Nudt14 UTSW 12 112941992 missense probably null 0.01
R5202:Nudt14 UTSW 12 112935028 missense probably damaging 1.00
R7193:Nudt14 UTSW 12 112939320 missense probably benign 0.24
X0019:Nudt14 UTSW 12 112938497 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGAGACCTTGCTACCCTC -3'
(R):5'- TGACAGGTCTGGAGTAGGACTG -3'

Sequencing Primer
(F):5'- GGTCACAGTGCTCAAAGCCAG -3'
(R):5'- TCTGGAGTAGGACTGACTAGCTCC -3'
Posted On2018-06-06