Incidental Mutation 'R6527:Tmem161b'
ID522019
Institutional Source Beutler Lab
Gene Symbol Tmem161b
Ensembl Gene ENSMUSG00000035762
Gene Nametransmembrane protein 161B
Synonyms2810446P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location84222296-84296141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84272264 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 128 (M128R)
Ref Sequence ENSEMBL: ENSMUSP00000055208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057495] [ENSMUST00000223827] [ENSMUST00000223862] [ENSMUST00000225069]
Predicted Effect probably benign
Transcript: ENSMUST00000057495
AA Change: M128R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055208
Gene: ENSMUSG00000035762
AA Change: M128R

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 485 1.3e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223827
AA Change: M128R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000223862
AA Change: M128R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224744
Predicted Effect probably benign
Transcript: ENSMUST00000225069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225126
Predicted Effect unknown
Transcript: ENSMUST00000225708
AA Change: M113R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit lethality before genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Tmem161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Tmem161b APN 13 84294596 splice site probably benign
IGL01086:Tmem161b APN 13 84222422 utr 5 prime probably benign
IGL01150:Tmem161b APN 13 84292407 nonsense probably null
IGL01566:Tmem161b APN 13 84294762 missense probably benign 0.35
IGL02183:Tmem161b APN 13 84272254 missense probably damaging 1.00
IGL02481:Tmem161b APN 13 84283993 missense probably damaging 0.99
IGL02519:Tmem161b APN 13 84294744 missense probably damaging 1.00
IGL03207:Tmem161b APN 13 84294595 splice site probably benign
R0015:Tmem161b UTSW 13 84222414 utr 5 prime probably null
R0376:Tmem161b UTSW 13 84292383 missense probably benign 0.43
R0613:Tmem161b UTSW 13 84251320 missense probably damaging 1.00
R1925:Tmem161b UTSW 13 84260229 missense probably benign 0.07
R1935:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R1936:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R2325:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R2988:Tmem161b UTSW 13 84292455 nonsense probably null
R4327:Tmem161b UTSW 13 84251240 missense probably damaging 1.00
R4525:Tmem161b UTSW 13 84257802 missense probably benign 0.00
R4558:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R5133:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5134:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5727:Tmem161b UTSW 13 84286790 missense possibly damaging 0.63
R5875:Tmem161b UTSW 13 84294858 missense probably damaging 1.00
R6217:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R6550:Tmem161b UTSW 13 84222418 start gained probably benign
R6551:Tmem161b UTSW 13 84222418 start gained probably benign
R6553:Tmem161b UTSW 13 84222418 start gained probably benign
R6554:Tmem161b UTSW 13 84222418 start gained probably benign
R6640:Tmem161b UTSW 13 84222418 start gained probably benign
R6641:Tmem161b UTSW 13 84222418 start gained probably benign
R6685:Tmem161b UTSW 13 84222418 start gained probably benign
R6836:Tmem161b UTSW 13 84222418 start gained probably benign
R6837:Tmem161b UTSW 13 84222418 start gained probably benign
R6838:Tmem161b UTSW 13 84222418 start gained probably benign
R7077:Tmem161b UTSW 13 84222418 start gained probably benign
R7078:Tmem161b UTSW 13 84222418 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGTCTAACATACTTACTGTTCC -3'
(R):5'- AACTGTCTGCTAGCCTTTCTGATATG -3'

Sequencing Primer
(F):5'- CCATAGATTTATCCTCATAAGCTCAC -3'
(R):5'- AGCCTTTCTGATATGCTACATGG -3'
Posted On2018-06-06