Incidental Mutation 'R6560:Has2'
ID 522038
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Name hyaluronan synthase 2
Synonyms
MMRRC Submission 044684-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6560 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 56529023-56557935 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56531660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 352 (T352S)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
AlphaFold P70312
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: T352S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: T352S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,843,230 (GRCm39) L1235Q probably damaging Het
Acin1 T C 14: 54,916,290 (GRCm39) T174A probably benign Het
Adamtsl1 G A 4: 86,255,130 (GRCm39) R733H probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arsk A T 13: 76,223,105 (GRCm39) I164N probably benign Het
Bbs5 T A 2: 69,487,300 (GRCm39) N194K probably damaging Het
Bicra T C 7: 15,723,119 (GRCm39) T133A possibly damaging Het
Card6 G A 15: 5,128,367 (GRCm39) P1010S probably damaging Het
Ccdc18 T A 5: 108,339,790 (GRCm39) N778K probably benign Het
Cept1 T C 3: 106,412,594 (GRCm39) I240V possibly damaging Het
Crip3 A G 17: 46,741,962 (GRCm39) R150G probably damaging Het
Cyp2c50 A G 19: 40,085,299 (GRCm39) T320A probably benign Het
Dio2 G C 12: 90,696,607 (GRCm39) S127* probably null Het
Dnai3 T C 3: 145,801,161 (GRCm39) E99G possibly damaging Het
Dscam T C 16: 96,626,935 (GRCm39) S325G probably benign Het
Exosc4 A G 15: 76,211,813 (GRCm39) I41V probably benign Het
Glb1l3 C T 9: 26,739,720 (GRCm39) probably null Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Gm3072 T A 14: 41,345,510 (GRCm39) D89V unknown Het
Gosr2 T C 11: 103,577,508 (GRCm39) H79R probably damaging Het
Insig1 T A 5: 28,276,531 (GRCm39) C32* probably null Het
Klf9 A G 19: 23,119,314 (GRCm39) S66G probably damaging Het
Mfn1 T C 3: 32,623,665 (GRCm39) I263T probably damaging Het
Myl2 G A 5: 122,240,834 (GRCm39) G38R probably null Het
Negr1 A G 3: 157,018,494 (GRCm39) T332A probably benign Het
Neo1 A G 9: 58,787,884 (GRCm39) S1417P possibly damaging Het
Or52ab4 T C 7: 102,987,945 (GRCm39) F228S probably benign Het
Or7e168 G A 9: 19,720,412 (GRCm39) S266N probably benign Het
Pcgf3 C A 5: 108,621,768 (GRCm39) H35Q probably damaging Het
Plppr5 A G 3: 117,465,639 (GRCm39) I297V probably benign Het
Plxna4 C T 6: 32,192,613 (GRCm39) V783M probably damaging Het
Prx A T 7: 27,214,746 (GRCm39) Q85H probably damaging Het
Tex14 T G 11: 87,388,688 (GRCm39) M305R possibly damaging Het
Ythdc1 T C 5: 86,964,467 (GRCm39) V92A probably benign Het
Zfp619 G A 7: 39,186,954 (GRCm39) E995K probably damaging Het
Zfp90 A G 8: 107,142,379 (GRCm39) R4G probably damaging Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56,545,072 (GRCm39) missense possibly damaging 0.51
IGL02027:Has2 APN 15 56,531,567 (GRCm39) missense probably damaging 1.00
IGL02178:Has2 APN 15 56,545,456 (GRCm39) missense probably damaging 1.00
IGL02493:Has2 APN 15 56,531,320 (GRCm39) missense probably damaging 1.00
IGL02533:Has2 APN 15 56,545,091 (GRCm39) missense probably benign 0.00
IGL03142:Has2 APN 15 56,545,491 (GRCm39) missense possibly damaging 0.92
IGL03240:Has2 APN 15 56,531,656 (GRCm39) missense probably damaging 1.00
R0189:Has2 UTSW 15 56,531,831 (GRCm39) missense probably damaging 1.00
R0362:Has2 UTSW 15 56,545,057 (GRCm39) missense probably damaging 1.00
R1377:Has2 UTSW 15 56,545,202 (GRCm39) missense probably damaging 1.00
R1762:Has2 UTSW 15 56,545,006 (GRCm39) missense probably benign 0.13
R1845:Has2 UTSW 15 56,531,974 (GRCm39) missense probably damaging 1.00
R2012:Has2 UTSW 15 56,531,264 (GRCm39) missense probably damaging 1.00
R2190:Has2 UTSW 15 56,531,183 (GRCm39) missense probably benign 0.00
R2656:Has2 UTSW 15 56,545,224 (GRCm39) missense possibly damaging 0.90
R2966:Has2 UTSW 15 56,545,533 (GRCm39) missense probably damaging 1.00
R4361:Has2 UTSW 15 56,545,344 (GRCm39) missense probably damaging 1.00
R5698:Has2 UTSW 15 56,531,312 (GRCm39) missense probably damaging 1.00
R5826:Has2 UTSW 15 56,531,498 (GRCm39) missense probably damaging 1.00
R5883:Has2 UTSW 15 56,531,459 (GRCm39) missense possibly damaging 0.49
R5942:Has2 UTSW 15 56,531,192 (GRCm39) nonsense probably null
R6433:Has2 UTSW 15 56,531,194 (GRCm39) missense possibly damaging 0.79
R6603:Has2 UTSW 15 56,531,968 (GRCm39) missense probably damaging 1.00
R7094:Has2 UTSW 15 56,545,017 (GRCm39) missense probably damaging 1.00
R7597:Has2 UTSW 15 56,531,817 (GRCm39) missense probably damaging 1.00
R7738:Has2 UTSW 15 56,531,108 (GRCm39) missense possibly damaging 0.89
R8060:Has2 UTSW 15 56,533,341 (GRCm39) missense probably benign 0.00
R8145:Has2 UTSW 15 56,545,175 (GRCm39) missense probably benign
R8915:Has2 UTSW 15 56,531,885 (GRCm39) missense probably damaging 1.00
R8964:Has2 UTSW 15 56,531,061 (GRCm39) missense probably damaging 0.96
R9144:Has2 UTSW 15 56,545,588 (GRCm39) missense probably benign 0.03
R9411:Has2 UTSW 15 56,531,306 (GRCm39) missense possibly damaging 0.62
R9416:Has2 UTSW 15 56,531,684 (GRCm39) missense probably damaging 1.00
R9551:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
R9552:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
Z1177:Has2 UTSW 15 56,544,979 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAGACCCACTAGCTGGACAG -3'
(R):5'- TGTACAGAAACTCCTTGCTGC -3'

Sequencing Primer
(F):5'- CCACTAGCTGGACAGTTAACAGG -3'
(R):5'- CAGAAACTCCTTGCTGCATGAATTTG -3'
Posted On 2018-06-06