Incidental Mutation 'R6529:Usp8'
ID522157
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126725378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 106 (I106V)
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably benign
Transcript: ENSMUST00000028841
AA Change: I95V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: I95V

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110416
AA Change: I106V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: I106V

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138859
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGGATCTGTGCATACTG -3'
(R):5'- ATGACTTGTTTGCAGGAAATGGC -3'

Sequencing Primer
(F):5'- AAGATACTTTGAGAGTTTTGGACAG -3'
(R):5'- TGCAGGAAATGGCTATTATAGGTATG -3'
Posted On2018-06-06