Incidental Mutation 'R6529:Klf15'
ID522178
Institutional Source Beutler Lab
Gene Symbol Klf15
Ensembl Gene ENSMUSG00000030087
Gene NameKruppel-like factor 15
SynonymsKKLF, 1810013I09Rik, CKLF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R6529 (G1)
Quality Score213.009
Status Validated
Chromosome6
Chromosomal Location90462576-90475238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90467412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 323 (T323I)
Ref Sequence ENSEMBL: ENSMUSP00000144808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032174] [ENSMUST00000113530] [ENSMUST00000203039] [ENSMUST00000203607]
Predicted Effect probably damaging
Transcript: ENSMUST00000032174
AA Change: T323I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032174
Gene: ENSMUSG00000030087
AA Change: T323I

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113530
AA Change: T323I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109158
Gene: ENSMUSG00000030087
AA Change: T323I

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203039
AA Change: T323I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144962
Gene: ENSMUSG00000030087
AA Change: T323I

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203607
AA Change: T323I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144808
Gene: ENSMUSG00000030087
AA Change: T323I

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000205136
AA Change: T98I
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display impaired gluconeogenesis with severe fasting induce hypoglycemia. Homozygotes are also more sensitive to induced cardiac stress and display mild cardiac and aortic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Klf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3425:Klf15 UTSW 6 90466820 missense probably benign 0.01
R5443:Klf15 UTSW 6 90467360 missense possibly damaging 0.50
R5985:Klf15 UTSW 6 90466721 missense possibly damaging 0.69
R6171:Klf15 UTSW 6 90466619 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTGCACTCCTGCCTCAAGTG -3'
(R):5'- CCACCTCATCTAATGGAGAAAGG -3'

Sequencing Primer
(F):5'- AAGTGGTACCATCCTCCAACTTG -3'
(R):5'- AAGGGACCTTGTCATACACTCGG -3'
Posted On2018-06-06