Incidental Mutation 'R6556:Dnajc14'
ID522185
Institutional Source Beutler Lab
Gene Symbol Dnajc14
Ensembl Gene ENSMUSG00000025354
Gene NameDnaJ heat shock protein family (Hsp40) member C14
SynonymsDRIP78, LIP6, HDJ3, 5730551F12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128804062-128819446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128814631 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 528 (D528G)
Ref Sequence ENSEMBL: ENSMUSP00000151343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026409] [ENSMUST00000026410] [ENSMUST00000217685] [ENSMUST00000217745] [ENSMUST00000219215] [ENSMUST00000219508] [ENSMUST00000219524]
Predicted Effect probably benign
Transcript: ENSMUST00000026409
SMART Domains Protein: ENSMUSP00000026409
Gene: ENSMUSG00000025353

DomainStartEndE-ValueType
Pfam:ORMDL 11 146 4.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026410
AA Change: D528G

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354
AA Change: D528G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217685
Predicted Effect probably benign
Transcript: ENSMUST00000217745
AA Change: D528G

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218765
Predicted Effect probably benign
Transcript: ENSMUST00000219215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably benign
Transcript: ENSMUST00000219508
AA Change: D528G

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Dnajc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Dnajc14 APN 10 128806332 missense probably damaging 1.00
IGL00924:Dnajc14 APN 10 128817319 missense probably benign
IGL00943:Dnajc14 APN 10 128816806 missense possibly damaging 0.92
IGL02833:Dnajc14 APN 10 128806599 missense possibly damaging 0.94
IGL02799:Dnajc14 UTSW 10 128806856 missense possibly damaging 0.88
PIT4812001:Dnajc14 UTSW 10 128806683 missense probably damaging 0.96
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R1932:Dnajc14 UTSW 10 128816792 missense probably damaging 1.00
R4412:Dnajc14 UTSW 10 128806205 start gained probably benign
R4717:Dnajc14 UTSW 10 128806244 missense possibly damaging 0.92
R4804:Dnajc14 UTSW 10 128814057 missense probably benign 0.06
R4870:Dnajc14 UTSW 10 128817350 missense probably benign 0.00
R6323:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6325:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6399:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6400:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6452:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6453:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6847:Dnajc14 UTSW 10 128816787 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AATCCTCTATTGGAAGGTCTTGTGG -3'
(R):5'- GTAGAAACCTTGGGAGTCAGTC -3'

Sequencing Primer
(F):5'- CAAGGGTTGACTATCAGATATCCTGC -3'
(R):5'- AAACCTTGGGAGTCAGTCTGTACTC -3'
Posted On2018-06-06