Mutagenetix > Incidental Mutation

Incidental Mutation 'R6529:Chd2'

522186

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

5630401D06Rik, 2810013C04Rik, 2810040A01Rik

MMRRC Submission

044655-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.578) question?

Stock #

R6529 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73076400-73191494 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73153191 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 219 (E219G)

Ref Sequence

ENSEMBL: ENSMUSP00000026895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000172704] [ENSMUST00000197642] [ENSMUST00000199601] [ENSMUST00000199641]

AlphaFold

E9PZM4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026895
AA Change: E219G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671
AA Change: E219G

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	146	160	N/A	INTRINSIC
low complexity region	199	208	N/A	INTRINSIC
CHROMO	224	310	2.3e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169922
AA Change: E255G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E255G

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172704

SMART Domains

Protein: ENSMUSP00000134484
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	34	89	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197642

SMART Domains

Protein: ENSMUSP00000142408
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
Blast:CHROMO	1	58	5e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199601

SMART Domains

Protein: ENSMUSP00000143203
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	2	65	8.1e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199641

SMART Domains

Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	1	38	1.2e-2	SMART
CHROMO	68	119	1.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205458

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206665

Meta Mutation Damage Score

0.0719

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	T	7: 78,739,479 (GRCm39)	M296L	probably benign	Het
Atxn2	T	C	5: 121,949,677 (GRCm39)		probably null	Het
B3galnt2	G	T	13: 14,170,377 (GRCm39)	R242S	probably benign	Het
Bltp3a	A	G	17: 28,098,750 (GRCm39)	I218M	possibly damaging	Het
Casz1	G	A	4: 149,022,646 (GRCm39)	E571K	probably damaging	Het
Ccdc163	A	G	4: 116,566,121 (GRCm39)		probably null	Het
Cd109	A	G	9: 78,619,907 (GRCm39)	D1383G	probably damaging	Het
Cd200r1	A	G	16: 44,610,065 (GRCm39)	T95A	possibly damaging	Het
Cibar1	A	G	4: 12,168,978 (GRCm39)	V175A	probably damaging	Het
Dnah14	T	A	1: 181,494,034 (GRCm39)	V1730D	probably damaging	Het
Eps8	G	A	6: 137,491,335 (GRCm39)	H348Y	possibly damaging	Het
Fbxo2	A	T	4: 148,249,511 (GRCm39)	D187V	probably damaging	Het
Fsip2	A	T	2: 82,812,657 (GRCm39)	Y2992F	probably benign	Het
Gle1	A	T	2: 29,825,539 (GRCm39)	T10S	possibly damaging	Het
Got2	T	C	8: 96,615,013 (GRCm39)		probably benign	Het
Gtf3c6	T	C	10: 40,127,251 (GRCm39)	T34A	probably benign	Het
H4c11	G	T	13: 21,919,476 (GRCm39)	V71F	possibly damaging	Het
Klf15	C	T	6: 90,444,394 (GRCm39)	T323I	probably damaging	Het
Krtap5-3	C	A	7: 141,756,079 (GRCm39)	C305*	probably null	Het
Map2k6	A	T	11: 110,383,388 (GRCm39)	D99V	probably damaging	Het
Nckap5l	G	T	15: 99,324,475 (GRCm39)	P676Q	probably benign	Het
Nup188	A	T	2: 30,216,466 (GRCm39)	T757S	possibly damaging	Het
Or10ak13	C	T	4: 118,638,907 (GRCm39)	V292I	probably benign	Het
Or51q1c	T	C	7: 103,653,133 (GRCm39)	V217A	probably benign	Het
Peg3	C	A	7: 6,711,071 (GRCm39)	A1384S	probably damaging	Het
Plekho2	C	T	9: 65,480,383 (GRCm39)	R14H	probably benign	Het
Qsox2	A	T	2: 26,107,753 (GRCm39)	C247S	probably damaging	Het
Slc25a13	A	G	6: 6,073,451 (GRCm39)	V469A	probably benign	Het
Slitrk3	T	C	3: 72,958,551 (GRCm39)	T74A	probably benign	Het
Spmip7	T	C	11: 11,465,009 (GRCm39)	F120S	possibly damaging	Het
Sult1a1	T	C	7: 126,274,310 (GRCm39)	T91A	probably benign	Het
Sult3a2	T	C	10: 33,655,733 (GRCm39)	Y82C	probably damaging	Het
Taf1b	A	T	12: 24,606,650 (GRCm39)	H490L	possibly damaging	Het
Trrap	T	A	5: 144,771,014 (GRCm39)	H2804Q	probably benign	Het
Usp8	A	G	2: 126,567,298 (GRCm39)	I106V	probably benign	Het
Wdcp	T	A	12: 4,901,143 (GRCm39)	V333D	probably damaging	Het
Wdr46	T	A	17: 34,168,120 (GRCm39)	L564Q	possibly damaging	Het
Wrn	T	C	8: 33,826,004 (GRCm39)		probably null	Het
Zfp664	C	T	5: 124,963,352 (GRCm39)	H249Y	probably damaging	Het
Zfp975	A	C	7: 42,311,325 (GRCm39)	H429Q	possibly damaging	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73,118,325 (GRCm39)	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73,190,576 (GRCm39)	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73,093,997 (GRCm39)	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73,091,434 (GRCm39)	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73,091,375 (GRCm39)	splice site	probably null
IGL02083:Chd2	APN	7	73,130,816 (GRCm39)	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73,091,465 (GRCm39)	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73,147,456 (GRCm39)	splice site	probably null
IGL02385:Chd2	APN	7	73,085,570 (GRCm39)	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73,097,068 (GRCm39)	unclassified	probably benign
IGL02590:Chd2	APN	7	73,102,948 (GRCm39)	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73,125,097 (GRCm39)	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73,143,204 (GRCm39)	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73,102,914 (GRCm39)	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73,151,852 (GRCm39)	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73,130,716 (GRCm39)	missense	probably benign
F6893:Chd2	UTSW	7	73,157,620 (GRCm39)	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73,134,282 (GRCm39)	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73,097,022 (GRCm39)	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73,134,265 (GRCm39)	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73,102,884 (GRCm39)	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73,140,362 (GRCm39)	nonsense	probably null
R1599:Chd2	UTSW	7	73,122,799 (GRCm39)	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73,130,178 (GRCm39)	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73,104,193 (GRCm39)	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73,079,735 (GRCm39)	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73,128,416 (GRCm39)	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73,153,168 (GRCm39)	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73,157,631 (GRCm39)	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73,118,238 (GRCm39)	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73,121,538 (GRCm39)	unclassified	probably benign
R3788:Chd2	UTSW	7	73,096,878 (GRCm39)	unclassified	probably benign
R3826:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73,114,143 (GRCm39)	splice site	probably benign
R4093:Chd2	UTSW	7	73,150,764 (GRCm39)	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73,085,709 (GRCm39)	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73,190,622 (GRCm39)	intron	probably benign
R4782:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73,151,873 (GRCm39)	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73,130,256 (GRCm39)	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73,079,437 (GRCm39)	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73,113,429 (GRCm39)	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73,122,833 (GRCm39)	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73,134,232 (GRCm39)	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73,141,105 (GRCm39)	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73,134,350 (GRCm39)	splice site	probably null
R5834:Chd2	UTSW	7	73,128,463 (GRCm39)	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73,187,060 (GRCm39)	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73,085,590 (GRCm39)	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73,094,071 (GRCm39)	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73,101,471 (GRCm39)	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73,113,419 (GRCm39)	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73,102,912 (GRCm39)	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73,130,154 (GRCm39)	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73,150,785 (GRCm39)	critical splice acceptor site	probably null
R6611:Chd2	UTSW	7	73,143,313 (GRCm39)	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73,140,230 (GRCm39)	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73,125,127 (GRCm39)	nonsense	probably null
R6860:Chd2	UTSW	7	73,147,558 (GRCm39)	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73,125,171 (GRCm39)	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73,134,159 (GRCm39)	nonsense	probably null
R7095:Chd2	UTSW	7	73,121,629 (GRCm39)	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73,119,418 (GRCm39)	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73,125,168 (GRCm39)	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73,101,556 (GRCm39)	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73,091,390 (GRCm39)	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73,085,521 (GRCm39)	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73,121,567 (GRCm39)	missense	probably null	1.00
R7898:Chd2	UTSW	7	73,169,223 (GRCm39)	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73,149,373 (GRCm39)	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73,085,628 (GRCm39)	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73,101,506 (GRCm39)	missense	probably benign
R8071:Chd2	UTSW	7	73,187,132 (GRCm39)	missense	probably benign
R8188:Chd2	UTSW	7	73,079,504 (GRCm39)	nonsense	probably null
R8196:Chd2	UTSW	7	73,118,285 (GRCm39)	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73,079,483 (GRCm39)	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73,140,245 (GRCm39)	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73,151,783 (GRCm39)	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73,153,210 (GRCm39)	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73,134,294 (GRCm39)	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73,143,192 (GRCm39)	missense	probably benign	0.39
R9009:Chd2	UTSW	7	73,140,402 (GRCm39)	missense	probably benign	0.12
R9021:Chd2	UTSW	7	73,091,393 (GRCm39)	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73,105,358 (GRCm39)	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73,143,279 (GRCm39)	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73,098,918 (GRCm39)	missense	probably null	1.00
R9501:Chd2	UTSW	7	73,130,294 (GRCm39)	missense	probably damaging	1.00
R9501:Chd2	UTSW	7	73,091,481 (GRCm39)	missense	possibly damaging	0.92
R9550:Chd2	UTSW	7	73,119,439 (GRCm39)	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73,130,230 (GRCm39)	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73,079,555 (GRCm39)	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73,169,410 (GRCm39)	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73,157,585 (GRCm39)	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73,118,334 (GRCm39)	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- GCTCTGTGTTAATGAGTAAGTACC -3'
(R):5'- AAGTAGGCCTTGAGTCTACTGAC -3'

Sequencing Primer
(F):5'- CAAAAATTTGTGGGCTCCAGATGC -3'
(R):5'- TGTAAATAACTGTTGGAGTCAATGTG -3'

Posted On

2018-06-06