Incidental Mutation 'R6529:Chd2'
ID522186
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73503443 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 219 (E219G)
Ref Sequence ENSEMBL: ENSMUSP00000026895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000172704] [ENSMUST00000197642] [ENSMUST00000199601] [ENSMUST00000199641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026895
AA Change: E219G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671
AA Change: E219G

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169922
AA Change: E255G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E255G

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172704
SMART Domains Protein: ENSMUSP00000134484
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 34 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197642
SMART Domains Protein: ENSMUSP00000142408
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
Blast:CHROMO 1 58 5e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199601
SMART Domains Protein: ENSMUSP00000143203
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 2 65 8.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199641
SMART Domains Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 1 38 1.2e-2 SMART
CHROMO 68 119 1.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206665
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTCTGTGTTAATGAGTAAGTACC -3'
(R):5'- AAGTAGGCCTTGAGTCTACTGAC -3'

Sequencing Primer
(F):5'- CAAAAATTTGTGGGCTCCAGATGC -3'
(R):5'- TGTAAATAACTGTTGGAGTCAATGTG -3'
Posted On2018-06-06