Incidental Mutation 'R6556:Sstr1'
ID 522195
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Name somatostatin receptor 1
Synonyms Smstr1, Smstr-1, sst1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 58258558-58261230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58260478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 367 (D367V)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
AlphaFold P30873
Predicted Effect possibly damaging
Transcript: ENSMUST00000044299
AA Change: D367V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: D367V

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110671
AA Change: D367V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: D367V

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atosb C T 4: 43,033,896 (GRCm39) R460H probably damaging Het
Atp2a1 G T 7: 126,049,434 (GRCm39) P536Q probably benign Het
Bnip5 T A 17: 29,123,585 (GRCm39) D114V probably damaging Het
Cabyr T A 18: 12,884,073 (GRCm39) S187T probably benign Het
Camkk1 A T 11: 72,924,696 (GRCm39) N303I probably benign Het
Cdh13 C T 8: 119,694,926 (GRCm39) P259S probably damaging Het
Csnk1g3 A G 18: 54,063,354 (GRCm39) D255G possibly damaging Het
Dennd5b A C 6: 148,915,749 (GRCm39) probably null Het
Dnajc14 A G 10: 128,650,500 (GRCm39) D528G probably benign Het
Edem1 T C 6: 108,831,318 (GRCm39) F593S probably benign Het
Efcab3 A G 11: 104,899,077 (GRCm39) N4343S probably null Het
Erbb2 G A 11: 98,326,908 (GRCm39) D1106N possibly damaging Het
Ermp1 T C 19: 29,590,321 (GRCm39) M794V possibly damaging Het
Fip1l1 T A 5: 74,707,838 (GRCm39) probably null Het
Gm20730 C T 6: 43,058,476 (GRCm39) C112Y probably damaging Het
Gtf2h1 T A 7: 46,458,089 (GRCm39) C245S probably damaging Het
Hdhd5 T C 6: 120,500,515 (GRCm39) H61R probably benign Het
Ighv1-71 A T 12: 115,706,092 (GRCm39) V31E probably damaging Het
Igsf9b T C 9: 27,240,851 (GRCm39) F688S probably damaging Het
Iqcd T C 5: 120,740,443 (GRCm39) V258A probably damaging Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Lpo G T 11: 87,708,589 (GRCm39) Y136* probably null Het
Med30 A G 15: 52,593,779 (GRCm39) probably benign Het
Mertk T A 2: 128,618,341 (GRCm39) V524D probably benign Het
Ndufb11b A G 15: 81,864,939 (GRCm39) D60G probably damaging Het
Or4c126 T A 2: 89,824,517 (GRCm39) F260Y probably benign Het
Or4c52 T C 2: 89,845,438 (GRCm39) Y55H probably damaging Het
Or5l13 T C 2: 87,780,320 (GRCm39) I86V probably benign Het
Pde6b T A 5: 108,569,367 (GRCm39) M358K possibly damaging Het
Prep GA G 10: 45,034,410 (GRCm39) probably null Het
Prpf4b G A 13: 35,080,015 (GRCm39) R793Q probably damaging Het
Rela T A 19: 5,697,366 (GRCm39) N524K probably damaging Het
Relch T A 1: 105,654,165 (GRCm39) F845I probably damaging Het
Rnaset2a T C 17: 8,360,480 (GRCm39) D74G probably damaging Het
Semp2l2a G A 8: 13,887,690 (GRCm39) Q134* probably null Het
Serinc2 T A 4: 130,152,064 (GRCm39) I267F probably damaging Het
Sesn3 T C 9: 14,232,549 (GRCm39) F274S possibly damaging Het
Spag1 T C 15: 36,195,553 (GRCm39) Y249H probably damaging Het
Tasor T G 14: 27,151,215 (GRCm39) Y64D probably benign Het
Tnnt1 T C 7: 4,512,576 (GRCm39) E110G probably damaging Het
Tpm1 T A 9: 66,935,451 (GRCm39) probably null Het
Unc93b1 T C 19: 3,994,105 (GRCm39) V412A probably benign Het
Uox G C 3: 146,330,403 (GRCm39) probably null Het
Usp44 T C 10: 93,681,870 (GRCm39) Y107H probably benign Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58,259,536 (GRCm39) missense probably benign
IGL01975:Sstr1 APN 12 58,260,412 (GRCm39) missense probably benign 0.01
R0019:Sstr1 UTSW 12 58,259,935 (GRCm39) missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58,259,935 (GRCm39) missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58,259,644 (GRCm39) missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58,260,528 (GRCm39) missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58,260,406 (GRCm39) missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58,260,108 (GRCm39) missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58,260,264 (GRCm39) missense possibly damaging 0.81
R2318:Sstr1 UTSW 12 58,259,562 (GRCm39) missense possibly damaging 0.77
R4588:Sstr1 UTSW 12 58,260,417 (GRCm39) missense probably benign 0.00
R5041:Sstr1 UTSW 12 58,259,941 (GRCm39) missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58,260,172 (GRCm39) missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58,260,456 (GRCm39) missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58,260,066 (GRCm39) missense probably benign 0.01
R7452:Sstr1 UTSW 12 58,260,142 (GRCm39) missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58,260,313 (GRCm39) missense probably damaging 1.00
R9036:Sstr1 UTSW 12 58,259,569 (GRCm39) missense possibly damaging 0.92
R9095:Sstr1 UTSW 12 58,259,620 (GRCm39) missense probably damaging 1.00
R9726:Sstr1 UTSW 12 58,259,484 (GRCm39) missense probably benign 0.03
Z1176:Sstr1 UTSW 12 58,260,312 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCAGTTGTCTGTCATCCTG -3'
(R):5'- CTTTGGTCCAGCTAACCAGG -3'

Sequencing Primer
(F):5'- GTCTGTCATCCTGGGCTATGC -3'
(R):5'- GCATCGCTGTCATGCACTATG -3'
Posted On 2018-06-06