Incidental Mutation 'R6529:Map2k6'
ID522213
Institutional Source Beutler Lab
Gene Symbol Map2k6
Ensembl Gene ENSMUSG00000020623
Gene Namemitogen-activated protein kinase kinase 6
SynonymsMAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110399122-110525522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110492562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 99 (D99V)
Ref Sequence ENSEMBL: ENSMUSP00000097831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020949
AA Change: D99V

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: D99V

DomainStartEndE-ValueType
S_TKc 53 314 2.82e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100260
AA Change: D99V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: D99V

DomainStartEndE-ValueType
Pfam:Pkinase 53 288 4.3e-47 PFAM
Pfam:Pkinase_Tyr 53 289 1.2e-32 PFAM
Pfam:Kinase-like 57 274 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146540
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Map2k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Map2k6 APN 11 110496411 missense probably damaging 1.00
IGL01778:Map2k6 APN 11 110512869 intron probably benign
IGL02058:Map2k6 APN 11 110492583 missense probably damaging 1.00
IGL02580:Map2k6 APN 11 110490841 missense probably damaging 0.98
IGL03139:Map2k6 APN 11 110496473 splice site probably benign
R0230:Map2k6 UTSW 11 110496455 missense probably damaging 1.00
R0361:Map2k6 UTSW 11 110499509 missense probably damaging 0.99
R0634:Map2k6 UTSW 11 110494343 nonsense probably null
R1716:Map2k6 UTSW 11 110497901 missense probably damaging 1.00
R2214:Map2k6 UTSW 11 110496341 missense probably damaging 1.00
R2279:Map2k6 UTSW 11 110499464 missense probably damaging 1.00
R4610:Map2k6 UTSW 11 110499474 missense probably damaging 1.00
R4677:Map2k6 UTSW 11 110399394 utr 5 prime probably benign
R5299:Map2k6 UTSW 11 110492963 missense probably benign 0.03
R5761:Map2k6 UTSW 11 110399371 utr 5 prime probably benign
R5996:Map2k6 UTSW 11 110497906 missense possibly damaging 0.77
R6391:Map2k6 UTSW 11 110490877 critical splice donor site probably null
R7020:Map2k6 UTSW 11 110506714 intron probably benign
R7345:Map2k6 UTSW 11 110492908 missense
Predicted Primers PCR Primer
(F):5'- ACAGCGTATGTTTAGCGACG -3'
(R):5'- AGGGATGGTTTCTCCTCAAGC -3'

Sequencing Primer
(F):5'- AGCGACGCTGTGGGTAG -3'
(R):5'- ATGGTTTCTCCTCAAGCTTTGAAATC -3'
Posted On2018-06-06