Incidental Mutation 'R6529:Nckap5l'
ID522223
Institutional Source Beutler Lab
Gene Symbol Nckap5l
Ensembl Gene ENSMUSG00000023009
Gene NameNCK-associated protein 5-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6529 (G1)
Quality Score182.009
Status Validated
Chromosome15
Chromosomal Location99422035-99457748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99426594 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 676 (P676Q)
Ref Sequence ENSEMBL: ENSMUSP00000023747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023747] [ENSMUST00000161948]
Predicted Effect probably benign
Transcript: ENSMUST00000023747
AA Change: P676Q

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023747
Gene: ENSMUSG00000023009
AA Change: P676Q

DomainStartEndE-ValueType
coiled coil region 22 104 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 158 178 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 351 364 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
low complexity region 799 817 N/A INTRINSIC
Pfam:NCKAP5 871 1173 6.8e-89 PFAM
low complexity region 1205 1217 N/A INTRINSIC
low complexity region 1302 1318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160500
Predicted Effect probably benign
Transcript: ENSMUST00000161004
SMART Domains Protein: ENSMUSP00000125080
Gene: ENSMUSG00000023009

DomainStartEndE-ValueType
Pfam:NCKAP5 5 112 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161948
SMART Domains Protein: ENSMUSP00000123858
Gene: ENSMUSG00000023009

DomainStartEndE-ValueType
coiled coil region 22 104 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Nckap5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Nckap5l APN 15 99423127 unclassified probably benign
IGL02568:Nckap5l APN 15 99425683 missense probably damaging 1.00
IGL02615:Nckap5l APN 15 99429382 missense possibly damaging 0.89
IGL02896:Nckap5l APN 15 99427210 missense possibly damaging 0.89
R0653:Nckap5l UTSW 15 99423246 missense probably damaging 1.00
R1931:Nckap5l UTSW 15 99427261 missense probably damaging 1.00
R1969:Nckap5l UTSW 15 99422818 missense probably damaging 1.00
R4434:Nckap5l UTSW 15 99422863 missense probably benign
R4490:Nckap5l UTSW 15 99426130 missense probably benign 0.00
R4606:Nckap5l UTSW 15 99429323 unclassified probably benign
R4817:Nckap5l UTSW 15 99423186 missense probably damaging 1.00
R5008:Nckap5l UTSW 15 99425850 missense possibly damaging 0.68
R5011:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5013:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5503:Nckap5l UTSW 15 99425622 missense probably damaging 1.00
R5627:Nckap5l UTSW 15 99427706 missense possibly damaging 0.69
R5715:Nckap5l UTSW 15 99423576 missense probably benign 0.01
R6000:Nckap5l UTSW 15 99426885 missense probably damaging 1.00
R6072:Nckap5l UTSW 15 99426654 missense probably damaging 1.00
R6104:Nckap5l UTSW 15 99423988 missense probably benign
R6198:Nckap5l UTSW 15 99425988 missense probably damaging 1.00
R6225:Nckap5l UTSW 15 99428024 missense possibly damaging 0.94
R6751:Nckap5l UTSW 15 99423161 missense probably damaging 1.00
R6866:Nckap5l UTSW 15 99426468 missense probably benign
R6869:Nckap5l UTSW 15 99426453 missense probably damaging 1.00
R7163:Nckap5l UTSW 15 99433473 missense probably damaging 0.98
R7174:Nckap5l UTSW 15 99424003 missense probably benign 0.09
R7239:Nckap5l UTSW 15 99426209 missense probably damaging 1.00
X0062:Nckap5l UTSW 15 99429410 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAGTCCCGGTTCCTG -3'
(R):5'- CCAGAATCTTGTCCCTACAGCG -3'

Sequencing Primer
(F):5'- CCTGCTGCTTCAGGCTG -3'
(R):5'- CCCCCAGGAGAAGAGCATG -3'
Posted On2018-06-06