Incidental Mutation 'R6529:Cd200r1'
ID522225
Institutional Source Beutler Lab
Gene Symbol Cd200r1
Ensembl Gene ENSMUSG00000022667
Gene NameCD200 receptor 1
SynonymsMox2r, OX2R, CD200R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44765736-44794978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44789702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000138076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057488] [ENSMUST00000134625] [ENSMUST00000231633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057488
AA Change: T95A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053822
Gene: ENSMUSG00000022667
AA Change: T95A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-47 BLAST
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134625
AA Change: T95A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138076
Gene: ENSMUSG00000022667
AA Change: T95A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231633
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display abnormal sleep patterns including fragmented vigilance states and diminished duration of wakefulness. Mice homozygous for a different knock-out allele exhibit protection from HSV-1 encephalitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Cd200r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Cd200r1 APN 16 44794309 missense possibly damaging 0.88
IGL02111:Cd200r1 APN 16 44788781 missense probably damaging 0.99
IGL02549:Cd200r1 APN 16 44789978 missense probably damaging 1.00
IGL03065:Cd200r1 APN 16 44794282 missense probably benign 0.00
R0218:Cd200r1 UTSW 16 44788743 splice site probably benign
R1512:Cd200r1 UTSW 16 44766027 missense probably benign 0.21
R3605:Cd200r1 UTSW 16 44789576 missense possibly damaging 0.90
R3877:Cd200r1 UTSW 16 44790011 missense probably damaging 0.97
R3963:Cd200r1 UTSW 16 44792795 missense probably benign 0.03
R4109:Cd200r1 UTSW 16 44790084 missense possibly damaging 0.95
R4171:Cd200r1 UTSW 16 44792764 missense probably damaging 0.98
R4296:Cd200r1 UTSW 16 44789670 missense probably damaging 0.98
R4396:Cd200r1 UTSW 16 44766054 missense probably benign 0.01
R4922:Cd200r1 UTSW 16 44789676 missense probably damaging 1.00
R5090:Cd200r1 UTSW 16 44789561 missense possibly damaging 0.79
R5302:Cd200r1 UTSW 16 44792809 missense possibly damaging 0.86
R5686:Cd200r1 UTSW 16 44790164 missense probably damaging 1.00
R5838:Cd200r1 UTSW 16 44766034 missense possibly damaging 0.75
R5886:Cd200r1 UTSW 16 44790203 missense possibly damaging 0.75
R5913:Cd200r1 UTSW 16 44789671 missense possibly damaging 0.50
R6959:Cd200r1 UTSW 16 44790176 missense probably damaging 0.99
R7185:Cd200r1 UTSW 16 44789612 missense probably benign 0.30
R7211:Cd200r1 UTSW 16 44788757 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTAATACTTCCATTAGTCAAGC -3'
(R):5'- ATTGTCACTTACCCAGCACTTG -3'

Sequencing Primer
(F):5'- CTGTGGATAGACCTAACTCACAAGG -3'
(R):5'- CATGTGTAAGTCCCCTCA -3'
Posted On2018-06-06