Incidental Mutation 'R6530:Asic4'
ID522235
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75472335 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 376 (N376S)
Ref Sequence ENSEMBL: ENSMUSP00000045598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113577] [ENSMUST00000138683]
Predicted Effect probably damaging
Transcript: ENSMUST00000037708
AA Change: N376S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: N376S

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079205
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094818
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113577
AA Change: N357S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: N357S

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194916
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
PIT4445001:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3614:Asic4 UTSW 1 75473058 missense probably damaging 1.00
R3790:Asic4 UTSW 1 75469841 unclassified probably benign
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5208:Asic4 UTSW 1 75451226 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6512:Asic4 UTSW 1 75473043 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTGAATGATCTGGCCTTC -3'
(R):5'- TAATGAATGGCACTCCGGGC -3'

Sequencing Primer
(F):5'- GATCTGGCCTTCTAAATGGACATGC -3'
(R):5'- AAAGAGGGCAGCTCCTTCC -3'
Posted On2018-06-06